Region-specific mechanosensation modulates Drosophila postural control behaviour
- Department of Neuroscience, Sussex Neuroscience, School of Life Sciences, University of Sussex, United Kingdom
Figures
Figure 1 with 1 supplement
Quantitative analysis of self-righting behaviour.
(A) Photographs (top) and diagrams (bottom) of the self-righting sequence of a first-instar Drosophila larva. After inversion of the normal posture, the self-righting sequence involves a 180° rotation of the body that begins at the head and takes around 3–5 s on average. (B) A phylogenetic tree of common model organisms, with a reference to documented self-righting behaviour on the right. (C) Experimental procedure for consistent recording of self-righting behaviour. Third-instar w1118 larvae were positioned on a dry coverslip with the dorsal side in contact with the surface before being placed in an arena for recording. Behaviour was ‘unlocked’ at the desired moment through the application of water with a moistened paintbrush. (D) Extraction of behavioural features with video tracking. Video frames were analysed using DeepLabCut, where four points along the anterior–posterior axis were labelled. The coordinates of these points were used to calculate speed of movement as well as angles of body curvature. (E) Mean head speed and (F) tail speed over the course of recordings. The lines show the mean taken over all samples while the shaded areas indicate the 95% CI. The time course has been normalised to account for differences in the length of behaviour. The dotted line in E indicates where the self-righting sequence is predicted to begin on average, based on head movement. (G) Mean speed of movement for the head and tail during the self-righting sequence. Points indicate mean speeds for individual samples, with measurements from the same larva being connected by lines. The box and whisker plots indicate the median, IQR, and 1.5 IQR. ***p < 0.001 for Wilcoxon signed-rank tests, n = 30. (H) Absolute angles of curvature of the head (purple) and tail (red) over the course of the self-righting sequence. The lines show the mean absolute angle while the shaded areas indicate the 95% CI. Due to the apparent curvature of the head in three discreet bursts, the head angles have been labelled I, II, and III. (I) The distribution of curvature angles for the head (purple) and tail (red), where negative values are left-handed bends and positive values are right-handed bends. The lines show a smoothed kernel density estimation for the probability density while the bars indicate counts binned to each 10°. (J) Mean absolute angle for the head and tail during the self-righting sequence. Points indicate mean speeds for individual samples, with measurements from the same larva being connected by lines. The box and whisker plots indicate the median, IQR, and 1.5 IQR. ***p < 0.001 for Wilcoxon signed-rank tests, n = 30. The median self-righting times before and after trimming based on head movement were 12.8 and 11.0 s, respectively.
Figure 1—figure supplement 1
Handedness of self-righting behaviour in 30 wild-type first instar larvae.
(A) Vector field plot of head and tail movements during SR behaviour. Vectors were generated by rounding coordinate data to the nearest 10 pixels, then summing coordinate changes over the time course of the behaviour. The length and opacity of the arrows represent the magnitude of the vector sums, reflecting the tendency for larvae to move the head or tail in a given direction within the x–y plane. (B) The proportion of time spent in left- or right-handed bends of the head or tail during SR behaviour. Bars indicate the mean proportion and points indicate proportions for individual larvae. ****p < 0.0001 for a two-sided exact binomial test with a null probability of 0.5, n = 30. (C) The proportion of larvae that completed the SR sequence with a left or right bend of the head and tail. Bars indicate the proportion, while the values above the bars indicate the number of larvae that displayed that direction of bend.
Figure 2
Effects of localised substrate contact on self-righting.
(A) Experimental procedure for investigating localised dorsal substrate contact. Third instar w1118 larvae were first placed dorsal side down on a dry glass coverslip in the desired position. Movement was then unlocked via the application of water with a paintbrush. (B) Photographs of larvae in three conditions of dorsal substrate contact. The red dashed line indicates the boundary of the coverslip. (C) Proportion of larvae that performed self-righting in the three conditions of dorsal substrate contact. Group comparison: Cochran’s Q(2) = 28.35, p < 0.001, n = 20. ***p < 0.001, **p < 0.01 for pairwise Cochran Q tests. (D) Self-righting times in the three conditions of dorsal substrate contact. For larvae that did not self-right within 60 s, the time is shown as 60. Points show times for individual tests, with measurements from the same larva being connected by lines. The box and whisker plots indicate the median, IQR, and 1.5 IQR. p = 0.047 for a Wilcoxon signed-rank test comparing the anterior and whole-body conditions, n = 17. (E) Experimental procedure for investigating the combination of whole-body dorsal substrate contact with localised ventral substrate contact. A coverslip was held inside a custom 3D-printed mount (red box) to provide consistent contact. Third instar larvae were placed ventral side down on the coverslip in the desired position. The coverslip and larva were then placed onto agar, providing whole-body dorsal contact and sufficient moisture for movement. Larvae generally performed crawling or self-righting. (F) Snapshots of larvae in the three conditions of ventral substrate contact. The red dashed line indicates the boundary of the coverslip. (G) Proportion of larvae that performed self-righting in the three conditions of ventral substrate contact. Group comparison: Cochran’s Q(2) = 29.50, p < 0.001, n = 20. ****p < 0.0001, ***p < 0.001 for pairwise Cochran Q tests. The mean self-righting time for larvae that performed self-righting with ventral contact was 32.8 s.
Figure 3 with 1 supplement
Conditional thermogenetic inhibition of multidendritic sensory neurons.
(A) The peripheral nervous system of the Drosophila larva. The diagram (top) shows the larva with the segmentally repeated clusters of sensory organs. The canonical hemisegmental arrangement (bottom) shows the sensory organs (grey circles), chordotonal organs (yellow triangles), and multidendritic neurons (green diamonds). Adapted from Orgogozo and Grueber, 2005. (B) A confocal z-projection of a stage 16 embryo with GFP expression in the 109(2)80-Gal4 domain. The embryo has been immunolabelled with anti-GFP (green), 22C10 (axonal tracts, red), and DAPI (nuclei, blue). (C) Experimental procedure for conditional inhibition of sensory neurons expressing shibire[ts] (shi[ts]). Self-righting is first performed with first instar larvae at 25°C, at which shibire is functional and synaptic transmission occurs normally. The substrate is then heated to 32°C and self-righting is tested again. This temperature impairs shibire function and inhibits synaptic vesicle recycling and release. The temperature is then lowered back to 25°C allowing restoration of shibire function. Self-righting is tested again to ensure recovery from the conditional inhibition. (D–F) Self-righting times for first-instar larvae expressing shibire in different sets of sensory neurons. In each case, the location of the sensory neuron population within the hemisegmental arrangement is shown (left). Box and whisker plots indicate self-righting times in each temperature condition, for UAS-shi[ts] controls (left) and age-matched experimental genotypes (right). The temporal order of the temperature conditions follows from top to bottom of each plot. *p < 0.05, **p < 0.01, ***p < 0.001 for pairwise Wilcoxon signed-rank tests. Individual observations are not displayed for visualisation purposes due to large variance. (C) Self-righting times of 109(2)80>shi[ts] larvae, expressing shi[ts] in all multidendritic neurons. n[exp] = 38, n[control] = 37. (D) Self-righting times of NompC>shi[ts] larvae, expressing shi[ts] in daIII neurons. n[exp] = 17, n[control] = 17. (E) Self-righting times of ppk>UAS-shi[ts] larvae, expressing shi[ts] in daIV neurons. n[exp] = 39, n[control] = 40.
Figure 3—figure supplement 1
Self-righting times for first-instar larvae expressing shibire in the chordotonal organs.
The location of the chordotonal organs within the hemisegmental sensory arrangement is shown (left). Box and whisker plots indicate self-righting times in each temperature condition, for UAS-shi[ts] controls (left) and age-matched experimental genotypes (right). The temporal order of the temperature conditions follows from top to bottom. **p < 0.01, ***p < 0.001 for pairwise Wilcoxon signed-rank tests.
Figure 4 with 2 supplements
Localised optogenetic inhibition of multidendritic sensory neurons along the anterior–posterior axis.
(A) Experimental setup for localised optogenetic inhibition. Inhibitory light was spatially restricted by means of a small slit in the base of a 3D-printed arena (left). The LED was positioned under the slit and operated by a switch, while an infrared camera recorded from above (right). (B) Experimental procedure for testing the effects of localised inhibition on self-righting. Larvae were positioned dorsal side down on a coverslip above the slit such that incoming light illuminated a group of three segments. After light activation, larvae were quickly unlocked through application of water and the time to complete self-righting was timed. (C) Photographs of the five experimental conditions of localised illumination. In each condition, light targeted a group of three segments along the anterior–posterior axis, while no light was used as a control condition. (D) Log-transformed time to self-right across the five illumination conditions for larvae expressing GtACR2 in the 109(2)80 domain. The bars show mean values, and points show individual measurements with measurements from the same larva being joined by grey lines. Analysis of deviance for a mixed model including control genotypes revealed a significant interaction of illumination condition and genotype (F(8, 468) = 10.35, p < 0.001, n = 40). ****p < 0.0001, NS = p > 0.05 for post hoc one-sided comparisons between conditions of light illumination, following Dunnet’s approach with Sidak’s adjustment for multiple comparisons. (E) Log-transformed time to self-right across the five illumination conditions for Gal4 (left) and UAS (right) genetic control lines. No statistical differences were observed between the control condition and the experimental illumination conditions for either control line.
Figure 4—figure supplement 1
Self-righting effects of localised optogenetic inhibition of daIV sensory neurons along the anterior–posterior axis.
(A) Log-transformed time to self-right across the five illumination conditions for larvae expressing GtACR2 in the ppk domain. The bars show mean values, and points show individual measurements with measurements from the same larva being joined by grey lines. Analysis of deviance for a mixed model including control genotypes revealed a significant interaction of illumination condition and genotype (F(8, 468) = 5.94, p < 0.001, n = 40). ****p < 0.0001, NS = p > 0.05 for post hoc one-sided comparisons between conditions of light illumination, following Dunnet’s approach with Sidak’s adjustment for multiple comparisons. Note that one single observation is not shown for visualisation purposes (value = 300 s). (B) Log-transformed time to self-right across the five illumination conditions for Gal4 (left) and UAS (right) genetic control lines. No statistical differences were observed between the control condition and the experimental illumination conditions for either control line. (C) tdTomato fluorescence intensity in ddaC expressed under 109(2)80 and ppk Gal4 drivers. The left panel shows a brightfield image of a third instar larva merged with the red fluorescence channel. The box shows a zoomed image of the region containing ddaC, which is circled. The right panel shows the mean grey value across four larvae expressing tdTomato.
Figure 4—video 1
The opto-axial technique for regional optogenetics.
The video shows a bird’s-eye perspective of the full opto-axial technique for regional sensory inhibition during self-righting. The larva has been positioned on a dry coverslip such that segments A1–A3 align with the arena slit. The blue LED under the arena is activated, and then the larva is freed to move by delivery of moisture using a fine paintbrush. The recording continues until after the larva has completed self-righting, at which point the tracheal trunks are visible along the dorsal side.
Figure 5 with 5 supplements
Behavioural changes occurring under localised optogenetic inhibition of sensory neurons.
(A) Labelling of recordings using DeepLabCut. Recordings of optogenetically inhibited larvae were first manually trimmed so they contained only the time from movement unlocking to completion of self-righting (top). These videos were then analysed by DeepLabCut, which tracked four points along the anterior–posterior axis: head (purple), anterior middle (cyan), posterior middle (yellow), and tail (red). The coordinates of these tracked points were then used to calculate features of self-righting. (B) Counts of the changes in head curvature direction under localised optogenetic inhibition of multidendritic neurons. The counts were calculated as the number of times a larva went from bending towards one direction with the head to bending in the other direction. Bars show the mean values for each condition, while points show counts for individual samples with measurements from the same larva being connected by lines. Analysis of deviance for a negative binomial model including control genotypes revealed a significant interaction of illumination condition and genotype (Χ2(8) = 40.41, p < 0.001, n = 40). ****p < 0.0001 for post hoc one-sided comparisons between conditions of light illumination, following Dunnet’s approach with Sidak’s adjustment for multiple comparisons. (C) Correlations between count of head direction changes and self-righting times, for all illumination conditions (left) and just the anterior illumination conditions (right) in 109(2)80>GtACR2 larvae. Points show individual observations, while the red line indicates a linear regression. p < 0.0001 for both Spearman correlations.
Figure 5—figure supplement 1
Mean head and tail speeds under regional illumination.
(A) Mean head speed for third instar larvae of the 109(2)80>GtACR2 genotype. (B) Mean tail speed for third-instar larvae of the 109(2)80>GtACR2 genotype. (C) Mean head speed for third instar larvae of the 109(2)80-Gal4 genotype. (D) Mean tail speed for third-instar larvae of the 109(2)80-Gal4 genotype. (E) Mean head speed for third instar larvae of the UAS-GtACR2 genotype. (F) Mean tail speed for third-instar larvae of the UAS-GtACR2 genotype. In all plots, the bars show mean values, and points show individual measurements with measurements from the same larva being joined by grey lines. Analysis of deviance for a mixed model predicting head speed from genotype and illumination condition revealed a significant interaction effect (F(8, 468) = 2.07, p = 0.037, n = 40). Similarly, analysis of deviance for an analogous mixed model predicting tail speed also revealed a significant interaction effect (F(8, 468) = 4.39, p < 0.001, n = 40). *p < 0.05, ***p < 0.001, and ****p < 0.0001 for post hoc two-sided comparisons between conditions of light illumination, following Dunnet’s approach with Sidak’s adjustment for multiple comparisons.
Figure 5—figure supplement 2
Mean head and tail absolute curvature angles under regional illumination.
(A) Mean head curvature for third instar larvae of the 109(2)80>GtACR2 genotype. (B) Mean tail curvature for third-instar larvae of the 109(2)80>GtACR2 genotype. (C) Mean head curvature for third instar larvae of the 109(2)80-Gal4 genotype. (D) Mean tail curvature for third-instar larvae of the 109(2)80-Gal4 genotype. (E) Mean head curvature for third instar larvae of the UAS-GtACR2 genotype. (F) Mean tail curvature for third-instar larvae of the UAS-GtACR2 genotype. In all plots, the bars show mean values, and points show individual measurements with measurements from the same larva being joined by grey lines. Analysis of deviance for a mixed model predicting head speed from genotype and illumination condition found a non-significant interaction effect (F(8, 468) = 1.06, p = 0.392, n = 40). Similarly, analysis of deviance for an analogous mixed model predicting tail speed also found a non-significant interaction effect (F(8, 468) = 0.68, p = 0.710, n = 40). Post hoc two-sided comparisons between conditions of light illumination following Dunnet’s approach found no significant differences between the groups.
Figure 5—figure supplement 3
Counts of changes in head angle direction under regional illumination for genetic control lines.
(A) Counts of changes in head angle direction across the five illumination conditions for third instar larvae of the 109(2)80-Gal4 genotype. The bars show mean values, and points show individual measurements with measurements from the same larva being joined by grey lines. (B) As A, but for larvae of the UAS-GtARC2 genotype. No statistical increases were observed between the control condition and the four illumination conditions.
Figure 5—figure supplement 4
Head casting patterns under localised optogenetic inhibition of daIV sensory neurons along the anterior–posterior axis.
(A) Counts of the changes in head curvature direction under localised optogenetic inhibition of daIV neurons. The counts were calculated as the number of times a larva went from bending towards one direction with the head to bending in the other direction. Bars show the mean values for each condition, while points show counts for individual samples with measurements from the same larva being connected by lines. Analysis of deviance for a negative binomial model including control genotypes revealed a significant interaction of illumination condition and genotype (Χ2(8) = 30.61, p < 0.001, n = 40). ****p < 0.0001 for post hoc one-sided comparisons between conditions of light illumination, following Dunnet’s approach with Sidak’s adjustment for multiple comparisons. (B) Correlations between count of head direction changes and self-righting times, for all illumination conditions (left) and just the anterior illumination conditions (right) in ppk >GtACR2 larvae. Points show individual observations, while the red line indicates a linear regression. p < 0.0001 for both Spearman correlations. Note that in all panels, one observation is not shown to improve visualisation (value = 1063 counts).
Figure 5—video 1
Postural tracking and feature extraction from the opto-axial technique.
The video shows the same experiment as in Figure 4—video 1, following analysis using DeepLabCut. The video has been trimmed so the start coincides with the moisture delivery (water unlocking) and the end coincides with the precise completion of self-righting. Points on the larva indicate the maximum-likelihood positions of the head (purple), anterior middle (cyan), posterior middle (yellow), and tail (red) as estimated by DeepLabCut. The text labels indicate in degrees the calculated curvature angles of the head and tail for each frame of the video (see methods for details).
Figure 6 with 1 supplement
Hox expression in the sensory system and its influence on self-righting behaviour.
(A) Quantification of Hox RNA expression in larval sensory neurons. The flow diagram (beginning bottom left) shows how sensory neurons were collected from dissected first instar larvae using fluorescence-activated cell sorting (FACS). RNA was extracted from the sorted cells and reverse transcribed to DNA for amplification of Hox gene products via polymerase chain reaction (PCR). The photograph (bottom right) shows an agarose gel electrophoresis following RT-PCR of Hox genes Antp, Ubx, abd-A and Abd-B. For each gene, ‘no tem’ indicates a no template cDNA control, ‘no RT’ indicates a no reverse transcription control, and ‘exp’ indicates the experimental lane. (B) Self-righting times of first instar larvae expressing a Hox gene RNAi construct in the 109(2)80 domain. ***p < 0.001, *p < 0.05 for Wilcoxon rank sum tests, n = 19–30. (C–F) Confocal images of immunolabelled stage 16 109(2)80>mCD8::GFP embryos. In each case, the large left panel is a maximum intensity z-projection. The white square indicates the region that is zoomed in the smaller panels to the right. These smaller panels show an individual z slice in the two separate channels and the channel overlay. Triangles indicate cells showing clear signal for Hox protein, and arrowheads indicate cells lacking signal for Hox protein. The strips on the right are zoomed sections of the z-projection, showing a range of cells in one embryonic hemisegment. The putative identities of these cells are indicated by red lines in accordance with the canonical hemisegmental diagram on the far right. (C) Embryo immunolabelled for Antp and GFP, dorsal view. (D) Embryo immunolabelled for Antp and GFP, ventrolateral view. (E) Embryo immunolabelled for Abd-B and GFP, dorsal view. (F) Embryo labelled for Abd-B and GFP, ventrolateral view.
-
Figure 6—source data 1
Original file of the full raw uncropped, unedited gel image depicting an agarose gel electrophoresis stained with ethidium bromide where the products of several RT-PCR reactions including no DNA template controls, no RT control and experimentals using primers specific for RP49 and the Hox genes Antennapedia, Ultrabithorax, abdominal A, and Abdominal B were resolved.
- https://cdn.elifesciences.org/articles/108505/elife-108505-fig6-data1-v1.zip
-
Figure 6—source data 2
Labelled original file of the full raw uncropped, unedited gel image depicting an agarose gel electrophoresis stained with ethidium bromide where the products of several RT-PCR reactions including no template controls, no RT control and experimentals using primers specific for RP49 and the Hox genes Antennapedia, Ultrabithorax, abdominal A, and Abdominal B were resolved.
Labels have been added indicating the relevant primer pairs used in each well (see bracket at the top) as well as the nature of the reaction (e.g. no DNA template, no RT control, experimental) for each primer pair. Amplicons (bands) of the expected size for each amplification reaction are labelled with asterisks.
- https://cdn.elifesciences.org/articles/108505/elife-108505-fig6-data2-v1.zip
Figure 6—figure supplement 1
Reduction of Hox gene expression within the ppk domain does not affect SR time.
Self-righting times of first instar larvae expressing a Hox gene RNAi construct in the ppk domain.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (D. melanogaster) | yw; 109(2)80-Gal4 | Bloomington Drosophila Stock Center | RRID:BDSC_8769 | y[1] w[*]; P{w[+mW.hs]=GawB}109(2)80 |
| Genetic reagent (D. melanogaster) | yw; 109(2)80-Gal4, UAS-mCD8::GFP | Bloomington Drosophila Stock Center | RRID:BDSC_8768 | y[1] w[*]; P{w[+mW.hs]=GawB}109(2)80, P{w[+mC]=UAS-mCD8::GFP.L}LL5 |
| Genetic reagent (D. melanogaster) | w;; ppk-Gal4 | Bloomington Drosophila Stock Center | RRID:BDSC_32079 | w[*]; P{w[+mC]=ppk-GAL4.G}3 |
| Genetic reagent (D. melanogaster) | w;; UAS-shi[ts] | Bloomington Drosophila Stock Center | RRID:BDSC_44222 | w[*]; P{w[+mC]=UAS-shi[ts1].K}3 |
| Genetic reagent (D. melanogaster) | w; UAS-GtACR2 | Bloomington Drosophila Stock Center | RRID:BDSC_92984 | w[*]; P{y[+t7.7] w[+mC]=UAS-GtACR2.d.EYFP}attP40 |
| Genetic reagent (D. melanogaster) | yv;; UAS-Antp- Valium10-RNAi | Bloomington Drosophila Stock Center | RRID:BDSC_27675 | y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02754}attP2 |
| Genetic reagent (D. melanogaster) | yv;; UAS-Ubx- Valium10-RNAi | Bloomington Drosophila Stock Center | RRID:BDSC_31913 | y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02202}attP2 |
| Genetic reagent (D. melanogaster) | yv;; UAS-AbdA- Valium10-RNAi | Bloomington Drosophila Stock Center | RRID:BDSC_28739 | y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF03167}attP2 |
| Genetic reagent (D. melanogaster) | yv;; UAS-AbdB- Valium10-RNAi | Bloomington Drosophila Stock Center | RRID:BDSC_26746 | y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02309}attP2 |
| Genetic reagent (D. melanogaster) | yw;; UAS-Valium10-GFP | Bloomington Drosophila Stock Center | RRID:BDSC_35786 | y[1] v[1]; P{y[+t7.7] v[+t1.8]=UAS-GFP.VALIUM10}attP2 |
| Genetic reagent (D. melanogaster) | w;; 10XUAS-GCaMP6s::tdTomato | Marta Zlatic Lab (Grover et al., 2020) | N/A | |
| Genetic reagent (D. melanogaster) | yw;; nompC-Gal4 | Bloomington Drosophila Stock Center | RRID:BDSC_36361 | y[1] w[*]; PBac{y[+mDint2] w[+mC]=nompC-GAL4.P}VK00014; Df(3L)Ly, sens[Ly-1]/TM6C, Sb[1] Tb[1] |
| Genetic reagent (D. melanogaster) | yw | Alonso Lab (Nash and Yarkin, 1974) | N/A | |
| Genetic reagent (D. melanogaster) | w1118 | Alonso Lab | N/A | Hazelrigg et al., 1984 |
| Antibody | anti-GFP (Chicken) | Abcam | Cat# ab13970 | IF(1:100) |
| Antibody | anti-Futsch / 22C10 (Mouse monoclonal) | DHSB | RRID:AB_528403 | IF(1:10) |
| Antibody | anti-Antp 4C3 (Mouse monoclonal) | DHSB | RRID:AB_528082 | IF(1:100) |
| Antibody | anti-ABD-B (1A2E9) (Mouse monoclonal) | DHSB | RRID:AB_528061 | IF(1:100) |
| Antibody | Alexa-Fluor anti-chicken A488 (Goat polyclonal) | Invitrogen | RRID:AB_2534096 | IF(1:500) |
| Antibody | Alexa-Fluor anti-mouse A555 (Donkey polyclonal) | Invitrogen | RRID:AB_2536180 | IF(1:500) |
| Sequence-based reagent | rp49_F | This paper | PCR primers | CCGCTTCAAGGGACAGTATC |
| Sequence-based reagent | rp49_R | This paper | PCR primers | GACAATCTCCTTGCGCTTCT |
| Sequence-based reagent | Antp_F | This paper | PCR primers | ACGGAGTCTACCCACTTAAA |
| Sequence-based reagent | Antp_R | This paper | PCR primers | GATCTGAGGTCACATGAGTTG |
| Sequence-based reagent | Ubx_F | This paper | PCR primers | GCAGCGCAATGAACTCGTAC |
| Sequence-based reagent | Ubx_R | This paper | PCR primers | TGCAGATGGTGGTTGGCATA |
| Sequence-based reagent | abd-a_F | This paper | PCR primers | TCCCTTCCAGATCTCCAGTG |
| Sequence-based reagent | abd-a_R | This paper | PCR primers | GTAGGCCTTTCAATCGATGC |
| Sequence-based reagent | Abd-b_F | This paper | PCR primers | GCTAGTCCAGCGATTGGAAG |
| Sequence-based reagent | Abd-b_R | This paper | PCR primers | GTCGGTTGGTCACACATCAG |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Region-specific mechanosensation modulates Drosophila postural control behaviour
eLife 14:RP108505.
https://doi.org/10.7554/eLife.108505.3
