Sex-biased expression of enteroendocrine cell-derived hormones contributes to higher fat storage in Drosophila females
- Department of Cellular and Physiological Sciences, Life Sciences Institute, The University of British Columbia, Canada
Figures
Figure 1 with 1 supplement
Sex differences in expression of gut-derived peptide hormones.
mRNA levels of AstA (p < 0.0001; Student’s t-test) (A), AstC (p = 0.0002; Mann–Whitney test) (B), Tk (p < 0.0001; Student’s t-test) (C), NPF (p = 0.0001; Student’s t-test) (D), and Dh31 (p = 0.0002; Mann–Whitney test) (E) in whole-body were significantly higher in 5-day-old w1118 males compared to females. n = 7–8 biological replicates. mRNA levels of AstA (p < 0.0001; Student’s t-test) (F), AstC (p = 0.001; Student’s t-test) (G), Tk (p < 0.0001; Student’s t-test) (H), NPF (p = 0.0015; Student’s t-test) (I), and Dh31 (p < 0.0001; Student’s t-test) (J) in heads were significantly higher in 5-day-old w1118 males compared to females. n = 8–10 biological replicates. (K) mRNA levels of AstA (p = 0.5039; Student’s t-test) in guts were not significantly different between 5-day-old w1118 females and males. n = 7 biological replicates. mRNA levels of AstC (p = 0.0002; Student’s t-test) (L), Tk (p < 0.0001; Student’s t-test) (M), and NPF (p = 0.0006; Mann–Whitney test) (N) in guts were significantly higher in 5-day-old w1118 females compared to males. n = 7 biological replicates. (O) mRNA levels of Dh31 (p = 0.7517; Student’s t-test) in guts were not significantly different between 5-day-old w1118 females and males. n = 7 biological replicates. All data plotted as mean ± SEM. ns indicates not significant with p > 0.05; **p < 0.01, ***p < 0.001, ****p < 0.0001. See also Figure 1—figure supplement 1.
Figure 1—figure supplement 1
Sex differences in mRNA levels of receptors for enteroendocrine (EE) cell-derived hormones.
(A) mRNA levels of AstA-R2 in whole-body (p < 0.0001; Student’s t-test) and in head (p = 0.0031; Student’s t-test) were significantly higher in 5-day-old w1118 males compared to females; no sex difference was observed in fat body (p = 0.3329; Student’s t-test). n = 6–8 biological replicates. (B) mRNA levels of AstC-R2 in whole-body (p < 0.0001; Student’s t-test) and in head (p < 0.0001; Student’s t-test) were significantly higher in 5-day-old w1118 males compared to females; no sex difference was observed in fat body (p = 0.3036; Student’s t-test). n = 6–10 biological replicates. (C) mRNA levels of TkR99D in whole-body (p < 0.0001; Student’s t-test) and in fat body (p = 0.0022; Mann–Whitney test) were significantly higher in 5-day-old w1118 males compared to females; no sex difference was observed in heads (p = 0.0946; Student’s t-test). n = 6–10 biological replicates. (D) mRNA levels of NPFR in whole-body (p < 0.0001; Student’s t-test) and in head (p = 0.0003; Student’s t-test) were significantly higher in 5-day-old w1118 males compared to females; no sex difference was observed in fat body (p = 0.8669; Student’s t-test). n = 6–9 biological replicates. (E) mRNA levels of Dh31-R in whole-body (p < 0.0001; Student’s t-test) and in head (p = 0.0085; Mann–Whitney test) were significantly higher in 5-day-old w1118 males compared to females; no sex difference was observed in fat body (p = 0.7585; Student’s t-test). n = 6–10 biological replicates. All data plotted as mean ± SEM. ns indicates not significant with p > 0.05; **p < 0.01, ***p < 0.001, ****p < 0.0001.
Figure 2 with 1 supplement
Sex determination gene transformer does not regulate sex differences in enteroendocrine (EE) cell-derived peptide mRNA levels.
For all data, cell-type-specific RNAi was considered to have a significant effect only if the experimental genotype (e.g., tissue-GAL4>UAS-RNAi) significantly differed from both parental strains (e.g., tissue-GAL4>+ and +>UAS-RNAi) with the same direction of effect. mRNA levels of AstA (A), AstC (B), Tk (C), NPF (D), and Dh31 (E) in the gut were measured in voila-GAL4>UAS-traF flies and respective genetic controls (voila-GAL4>+ and +>UAS-traF) in females and males. Tra expression did not alter AstA (female: pGAL4 > 0.9999 and pUAS > 0.9999; male: pGAL4 > 0.9999 and pUAS = 0.0084), AstC (female: pGAL4 = 0.6814 and pUAS = 1.0; male: pGAL4 = 0.9965 and pUAS = 0.0463), Tk (female: pGAL4 = 0.2258 and pUAS > 0.9999; male: pGAL4 = 0.0006 and pUAS = 0.0004), NPF (female: pGAL4 = 0.1579 and pUAS = 0.3389; male: pGAL4 = 0.6639 and pUAS = 0.9043), or Dh31 (female: pGAL4 = 0.0439 and pUAS = 0.9745; male: pGAL4 = 0.9953 and pUAS = 0.1370) levels in either sex. Sex:genotype interaction: AstA (p < 0.0001), AstC (p = 0.1078), Tk (p = 0.0004), NPF (p = 0.1655), and Dh31 (p = 0.1945). Data were analyzed by two-way ANOVA with Bonferroni or Tukey’s HSD post hoc tests as appropriate (aligned rank transform applied for non-parametric data in B and E); n = 5 biological replicates. mRNA levels of AstA (F), AstC (G), Tk (H), NPF (I), and Dh31 (J) in the head were measured in voila-GAL4>UAS-traF flies and respective genetic controls (voila-GAL4>+ and +>UAS-traF) in females and males. Tra expression did not alter AstA (female: pGAL4 > 0.9999 and pUAS = 0.3344; male: pGAL4 > 0.9999 and pUAS > 0.9999), AstC (female: pGAL4 > 0.9999 and pUAS < 0.0001; male: pGAL4 = 0.6687 and pUAS = 0.0236), NPF (female: pGAL4 > 0.9999 and pUAS = 0.0006; male: pGAL4 = 0.5030 and pUAS = 0.6158), or Dh31 (female: pGAL4 > 0.9999 and pUAS = 0.0003; male: pGAL4 > 0.9999 and pUAS > 0.9999) levels in either sex. In females, Tk (pGAL4 > 0.9999 and pUAS = 0.0044) levels did not alter, but in males, Tk was increased compared with both controls (pGAL4 = 0.0120 and pUAS = 0.0156). Sex:genotype interaction: AstA (p = 0.2471), AstC (p = 0.0189), Tk (p = 0.0003), NPF (p = 0.1408), and Dh31 (p = 0.0403). Data were analyzed by two-way ANOVA with Bonferroni post hoc tests; n = 8 biological replicates. mRNA levels of AstA (K), AstC (L), Tk (M), NPF (N), and Dh31 (O) in the gut were measured in elav-GAL4>UAS-traF flies and respective genetic controls (elav-GAL4>+ and +>UAS-traF) in females and males. Neuronal Tra expression did not alter AstA (female: pGAL4 > 0.9999 and pUAS = 0.0534; male: pGAL4 = 0.5496 and pUAS = 0.1858), AstC (female: pGAL4 = 0.5948 and pUAS = 0.0878; male: pGAL4 = 0.1745 and pUAS = 0.1745), Tk (female: pGAL4 > 0.9999 and pUAS = 0.0269; male: pGAL4 > 0.9999 and pUAS = 0.2110), NPF (female: pGAL4 > 0.9999 and pUAS = 0.1158; male: pGAL4 > 0.9999 and pUAS = 0.6652), or Dh31 (female: pGAL4 = 0.5442 and pUAS = 0.8086; male: pGAL4 = 0.1650 and pUAS = 0.5258) levels in either sex. Sex:genotype interaction: AstA (p = 0.6125), AstC (p = 0.4992), Tk (p = 0.5212), NPF (p = 0.6546), and Dh31 (p = 0.9566). Data were analyzed by two-way ANOVA with Bonferroni or Tukey’s HSD post hoc tests as appropriate (aligned rank transform applied for non-parametric data in L and O); n = 6 biological replicates. mRNA levels of AstA (P), AstC (Q), Tk (R), NPF (S), and Dh31 (T) in the head were measured in elav-GAL4>UAS-traF flies and respective genetic controls (elav-GAL4>+ and +>UAS-traF) in females and males. Neuronal Tra expression did not alter AstA (female: pGAL4 = 0.9843 and pUAS = 0.7086; male: pGAL4 = 0.0628 and pUAS = 0.9936), AstC (female: pGAL4 = 0.1253 and pUAS = 0.8540; male: pGAL4 = 0.9086 and pUAS = 0.0188), Tk (female: pGAL4 = 0.6051 and pUAS = 0.9999; male: pGAL4 = 0.3600 and pUAS = 0.2760), or Dh31 (female: pGAL4 > 0.9999 and pUAS > 0.9999; male: pGAL4 = 0.2918 and pUAS = 0.5990) levels in either sex. NPF was reduced in females compared with both controls (pGAL4 = 0.0347 and pUAS = 0.0273) but was unchanged in males (pGAL4 = 0.0656 and pUAS = 0.6253). Sex:genotype interaction: AstA (p = 0.0171), AstC (p = 0.0198), Tk (p = 0.2324), NPF (p = 0.6872), and Dh31 (p = 0.4360). Data were analyzed by two-way ANOVA with Tukey’s HSD or Bonferroni post hoc tests as appropriate (aligned rank transform applied for non-parametric data in P, Q, R, S); n = 5–6 biological replicates. All data plotted as mean ± SEM. ns indicates not significant with p > 0.05; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. See also Figure 2—figure supplement 1.
Figure 2—figure supplement 1
Sex determination gene transformer does not regulate mRNA levels of receptors for enteroendocrine (EE) cell-derived hormones.
(A) mRNA levels of AstC-R2 in head were not significantly different in elav-GAL4>UAS-traF females and males compared with controls (female: pGAL4 = 0.9977 and pUAS = 0.9838; male: pGAL4 = 0.9998 and pUAS = 1.0) (sex:genotype interaction p = 0.8735). Two-way ANOVA followed by Tukey HSD on data processed using the aligned rank transform for non-parametric data; n = 5–6 biological replicates. (B) mRNA levels of TkR99D in head were not significantly different in elav-GAL4>UAS-traF females and males compared with controls (female: pGAL4 > 0.9999 and pUAS = 0.4552; male: pGAL4 > 0.9999 and pUAS > 0.9999) (sex:genotype interaction p = 0.1903). Two-way ANOVA followed by Bonferroni post hoc test; n = 5–6 biological replicates. (C) mRNA levels of Dh31-R in head were not significantly different in elav-GAL4>UAS-traF females and males compared with controls (female: pGAL4 = 0.7154 and pUAS = 0.2409; male: pGAL4 > 0.9999 and pUAS = 0.7312) (sex:genotype interaction p = 0.1210). Two-way ANOVA followed by Bonferroni post hoc test; n = 5–6 biological replicates. All data plotted as mean ± SEM. ns indicates not significant with p > 0.05.
Figure 3
Gut-derived Allatostatin C promotes female fat storage.
For all data, cell-type-specific RNAi was considered to have a significant effect only if the experimental genotype (e.g., tissue-GAL4>UAS-RNAi) significantly differed from both parental strains (e.g., tissue-GAL4>+ and +>UAS-RNAi) with the same direction of effect. (A) Whole-body triglyceride levels were significantly lower in AstC-GAL4>UAS-AstC-RNAi,R57C10-GAL80 females compared with AstC-GAL4>+,R57C10-GAL80 and +>UAS-AstC-RNAi control females (pGAL4 < 0.0001 and pUAS < 0.0001), an effect that was not observed in males (pGAL4 = 0.4527 and pUAS = 0.1056) (sex:genotype interaction p < 0.0001). Two-way ANOVA followed by Bonferroni post hoc test; n = 8 biological replicates. (B) Whole-body triglyceride levels were not significantly different in Tk-GAL4>UAS-Tk-RNAi,R57C10-GAL80 females and males compared with controls (female: pGAL4 = 0.1109 and pUAS = 0.0118; male: pGAL4 < 0.0001 and pUAS = 0.5704) (sex:genotype interaction p < 0.0001) though we note a trend toward lower body fat in females. Two-way ANOVA followed by Bonferroni post hoc test; n = 8 biological replicates. (C) Whole-body triglyceride levels were not significantly different in NPF-GAL4>UAS-NPF-RNAi,R57C10-GAL80 females and males compared with controls (female: pGAL4 > 0.9999 and pUAS > 0.9999; male: pGAL4 > 0.9999 and pUAS = 0.4134) (sex:genotype interaction p = 0.2890). Two-way ANOVA followed by Bonferroni post hoc test; n = 8 biological replicates. All data plotted as mean ± SEM. ns indicates not significant with p > 0.05; **p < 0.01, ****p < 0.0001.
Figure 4
Allatostatin C and Tachykinin receptors in neurons promote fat storage in females but not males.
For all data, cell-type-specific RNAi was considered to have a significant effect only if the experimental genotype (e.g., tissue-GAL4>UAS-RNAi) significantly differed from both parental strains (e.g., tissue-GAL4>+ and +>UAS-RNAi) with the same direction of effect. Whole-body triglyceride levels were measured in elav-GAL4>UAS-RNAi flies targeting AstC-R2 (A), TkR99D (B), and NPFR (C), along with respective genetic controls (elav-GAL4>+ and +>UAS-RNAi) in females and males. Knock-down of AstC-R2 (female: pGAL4 = 0.0001 and pUAS = 0.0013; male: pGAL4 = 0.0564 and pUAS > 0.9999; sex:genotype interaction p = 0.0631) and TkR99D (female: pGAL4 < 0.0001 and pUAS < 0.0001; male: pGAL4 > 0.9999 and pUAS > 0.9999; sex:genotype interaction p < 0.0001) significantly reduced triglyceride levels in females compared with no significant differences in males. Knock-down of NPFR did not change triglyceride levels in either females or males compared with controls (female: pGAL4 < 0.0001 and pUAS > 0.9999; male: pGAL4 < 0.0001 and pUAS > 0.9999; sex:genotype interaction p = 0.2470). Data were analyzed by two-way ANOVA followed by Bonferroni post hoc tests; n = 8 biological replicates. (D) Whole-body triglyceride levels were not significantly different in dilp2-GAL4>UAS-AstC-R2-RNAi females and males compared with controls (female: pGAL4 < 0.0001 and pUAS > 0.9999; male: pGAL4 = 0.0156 and pUAS = 0.3419; sex:genotype interaction p < 0.0001). Two-way ANOVA followed by Bonferroni post hoc test; n = 8 biological replicates. (E) Whole-body triglyceride levels were not significantly different in dilp2-GAL4>UAS-TkR99D-RNAi females compared with controls (pGAL4 = 0.0321 and pUAS = 0.0724). Whole-body triglyceride levels were significantly higher in dilp2-GAL4>UAS-TkR99D-RNAi males compared with dilp2-GAL4>+ and +>UAS-TkR99D-RNAi control males (pGAL4 < 0.0001 and pUAS = 0.0003; sex:genotype interaction p < 0.0001). Two-way ANOVA followed by Bonferroni post hoc test; n = 8 biological replicates. (F) Whole-body triglyceride levels were not significantly different in Akh-GAL4>UAS-AstC-R2-RNAi females and males compared with controls (female: pGAL4 = 0.3817 and pUAS = 0.0181; male: pGAL4 = 0.1229 and pUAS > 0.9999; sex:genotype interaction p = 0.0241). Two-way ANOVA followed by Bonferroni post hoc test; n = 8 biological replicates. (G) Whole-body triglyceride levels were not significantly different in Akh-GAL4>UAS-TkR99D-RNAi females and males compared with controls (female: pGAL4 = 0.4601 and pUAS > 0.9999; male: pGAL4 > 0.9999 and pUAS = 0.8744; sex:genotype interaction p = 0.0595). Two-way ANOVA followed by Bonferroni post hoc test; n = 8 biological replicates. All data plotted as mean ± SEM. ns indicates not significant with p > 0.05; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
Figure 5
Model of sex differences in fat storage.
Schematic representation of complex mechanisms that promote higher fat storage in Drosophila females. Profound female-biased EE cell-derived Tk and AstC promote female fat storage, an effect mediated by neurons but independent of the IPC or APC. EE cell-derived factors therefore act alongside a greater insulin/insulin-like growth factor signaling pathway activity, lower Adipokinetic hormone (Akh) signaling, and lower expression of triglyceride lipase brummer (bmm) to specify higher adiposity in female flies. In males, we detected no contribution of gut-derived factors to fat storage, which we previously showed is kept at a lower level than in females by higher bmm expression and Akh signaling. Thus, multiple complex mechanisms specify higher fat storage in unmated female flies compared with males. IPCs: insulin-producing cells; APCs: adipokinetic hormone-producing cells; CNS: central nervous system; bmm: brummer; EC: enterocyte; EB: enteroblast; EE: enteroendocrine; ISC: intestinal stem cells; AstC: Allatostatin C; Tk: Tachykinin; Dilps: Drosophila insulin-like peptides; Akh: Adipokinetic hormones. Created with BioRender.com.
Tables
Table 1
List of primers.
| Gene name | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| Beta tubulin | ATCATCACACACGGACAGGA | GAGCTGGATGATGGGGAGTA |
| Actin5C | TTGTCTGGGCAAGAGGATCAG | ACCACTCGCACTTGCACTTTC |
| AstA | TTTAGTCCGCGGAACCTCTG | GCTGCTGCTACTGAGCGAAT |
| AstC | TACGGCCTACTCCTCACCC | GCTGGCATATCGTAGCCACC |
| Tk | TGGCAAGAAGAGCGATCTGG | CCTACTCGAAAAGTGCTGGC |
| NPF | GGCTGATGCCTACAAGTTCCT | CTCATTAAAACCGCGAGCAAATTC |
| Dh31 | TCTCAAAGCGGTGCAGTCAG | TGCGGCTGTCTCCCTTTTTC |
| AstA-R2 | CGAACACCCTCACCAAGCTA | GGAGCAGTTAACGGCCTTGT |
| AstC-R2 | ACTGAATCTGGCTATCGCGG | TGCTCACCATGTAGGCCTTG |
| TkR99D | GATGAATTCGCGCTTTCGCT | ATTCGATGCGACTTGGGTGA |
| NPFR | TTTGCATGCTCCAAACGTCG | CAGCCAGAGTGTTTCCCGAT |
| Dh31-R | CCACTCAGGTCTCGTTCTTTTG | CTGCTGATCCGTGGACAACT |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/109426/elife-109426-mdarchecklist1-v1.docx
-
Source data 1
Raw data with calculations.
- https://cdn.elifesciences.org/articles/109426/elife-109426-data1-v1.xlsx
-
Source data 2
Statistics for all data.
- https://cdn.elifesciences.org/articles/109426/elife-109426-data2-v1.xlsx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Sex-biased expression of enteroendocrine cell-derived hormones contributes to higher fat storage in Drosophila females
eLife 14:RP109426.
https://doi.org/10.7554/eLife.109426.3
