Circadian photoreceptor CRYPTOCHROME promotes wakefulness under short winter-like days via a GABAergic circuitry
- Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology, China
- National "111" Center for Cellular Regulation and Molecular Pharmaceutics, Key Laboratory of Fermentation Engineering (Ministry of Education), Hubei University of Technology, China
- Hubei Province Key Laboratory of Oral and Maxillofacial Development and Regeneration, China
Figures
Figure 1 with 1 supplement
cry mutation increases sleep duration selectively under short photoperiods.
(A) Daily sleep duration in male circadian clock gene mutants per0, tim0, clkjrk, cyc0, and cryb compared to wild-type (WT) males under 4L20D, 8L16D, 12L12D, 16L8D, 20L4D (12L12D, n=86, 63, 91, 14, 91, 53 flies; 8L16D, n=21, 31, 31, 10, 32, 31 flies; 12L12D, n=31, 14, 32, 14, 27, 32 flies; 16L8D, n=36, 30, 33, 17, 36, 30 flies; 20L4D, n=42, 55, 83, 26, 91, 89 flies). (B) Average sleep traces of cryb and WT male flies under 4L20D. (C–F) The daily sleep duration (C), waking activity (D), sleep bout number (E), average sleep bout length (F) for cryb and WT female and male flies under 4L20D (n=56, 88, 58, 91 flies). For (B), statistical differences between cryb and WT are determined by paired two-tailed t-test, *p<0.001. For A and C–E, statistical differences are determined by two-tailed Student’s t-test, ***p<0.001. Error bars represent standard error of the mean (SEM). ZT, Zeitgeber time (ZT0 is the time of lights on).
-
Figure 1—source data 1
Numerical data with associated statistical analyses underlying Figure 1.
- https://cdn.elifesciences.org/articles/92608/elife-92608-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
cry knock-out mutation lengthens sleep duration under 4L20D.
Daily sleep duration of male wild-type (WT) flies and cry knock-out flies, monitored under 4L20D (n=53, 35, 47). Student’s t-test: *p<0.05. Error bars represent SEM.
Figure 2 with 5 supplements
CRY functions in GABAergic neurons and promotes wakefulness via GABA signaling.
(A–C) Daily sleep duration of male flies with cry knocked down in GABAergic neurons by VGATGAL4 (A) (n=34, 31, 31, 25, 23 flies), Gad1GAL4-1 (B) (n=29, 26, 29, 23, 32 flies), or Gad1GAL4-2 (C) (n=72, 74, 96, 49, 54 flies) monitored under 4L20D. (D) Daily sleep duration of cry knocked down in GABAergic neurons by Gad1GAL4 monitored under 12L12D (n=20, 19, 30, 26, 32, 20 flies). For A–D, one-way ANOVA with Bonferroni multiple comparison test: compared to GAL4 control, ***p<0.001; compared to UAS control, #p<0.05, ###p<0.001. (E) Daily sleep duration of male wild-type (WT) and cryb flies fed with EOS or nipecotic acid (NipA) under 4L20D (n=31, 32, 30, 30, 25, 32 flies). Two-tailed Student’s t-test: compared to WT, ###p<0.001; compared to vehicle control, *p<0.05, ***p<0.001. (F) Daily sleep duration of cry RNAi and control flies fed with NipA under 4L20D (n=29, 19, 26, 15, 28, 23, 24, 26, 15, 24 flies). For comparison between RNAi flies vs. UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, ***p<0.001; compared to UAS control, ###p<0.001. For comparing to vehicle control, two-tailed Student’s t-test was used, $$$p<0.001. (G) Daily sleep duration of male flies with cry and gad1 knocked down in GABAergic neurons monitored under 4L20D (n=72, 73, 24, 33, 45, 33, 27 flies). For comparison between RNAi flies vs. UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, **p<0.01, ***p<0.001; compared to UAS control, ###p<0.001. For comparing to RNAi control, two-tailed Student’s t-test was used: compared to UAScryRNAi/GAL4 control, $$$p<0.001; compared to UASGad1RNAi/GAL4 control, &&&p<0.001. (H) Daily sleep duration of male flies with cry and VGAT knocked down in GABAergic neurons monitored under 4L20D (n=72, 73, 46, 41, 45, 66, 34 flies). For comparison between RNAi flies vs. UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, ***p<0.001; compared to UAS control, #p<0.05, ### p<0.001. For comparing to RNAi control, two-tailed Student’s t-test was used: compared to UAScryRNAi/GAL4 control, $$$p<0.001; compared to UASVGATRNAi/GAL4 background, not significant. (I) Daily sleep duration of cry mutant flies with VGAT knocked down in GABAergic neurons monitored under 4L20D (n=72, 59, 20, 23, 69, 22 flies). For comparison between RNAi flies vs. UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, **p<0.01, ***p<0.001; compared to UAS control, #p<0.05, ###p<0.001. For comparison between mutant vs. control, two-tailed Student’s t-test was used: compared to WT background, &&&p<0.001; compared to UVGATRNAi/GAL4, not significant. Error bars represent standard error of the mean (SEM); G4, GAL4; U, UAS; NS, not significant.
-
Figure 2—source data 1
Numerical data with associated statistical analyses underlying Figure 2.
- https://cdn.elifesciences.org/articles/92608/elife-92608-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
CRY does not regulate sleep duration via TIM.
Daily sleep duration of male wild-type (WT) flies and flies mutant for cry and/or tim, monitored under 4L20D (n=58, 63, 91, 33 flies). Two-tailed Student’s t-test: compared to WT background, ***p<0.001; compared to tim0, ###p<0.001. Error bars represent standard error of the mean (SEM).
Figure 2—figure supplement 2
Screening for anatomical substrates that mediate the effects of CRY on sleep/wakefulness.
(A) Difference in sleep duration between male cry RNAi flies compared to GAL4 and UAS controls under 4L20D (n=20–92). (B) Plots of relative mRNA abundance for cry determined by quantitative real-time PCR (qRT-PCR) in whole-head extracts of cryRNAi and control flies under 4L20D (n=4). The value of the GAL4 control group was set to 1. Mann-Whitney test: compared to GAL4 control, *p<0.05; compared to UAS control, #p<0.05. G4, GAL4; U, UAS.
Figure 2—figure supplement 3
CRY promotes wakefulness in GABAergic neurons.
(A–D) Sleep profile (A), daily waking activity (B), sleep bout number (C), average sleep bout length (D) of male flies with cry knocked down in GABAergic neurons by VGATGAL4 monitored under 4L20D in Figure 2A. (E–H) Sleep profile (E), daily waking activity (F), sleep bout number (G), average sleep bout length (H) of male flies with cry knocked down in GABAergic neurons by Gad1GAL4-1 monitored under 4L20D in Figure 2B. (I–L) Sleep profile (I), daily waking activity (J), sleep bout number (K), average sleep bout length (L) of male flies with cry knocked down in GABAergic neurons by Gad1GAL4-2 monitored under 4L20D in Figure 2C. One-way ANOVA with Bonferroni multiple comparison test: compared to GAL4 control, ***p<0.001; compared to UAS control, #p<0.05, ###p<0.001.
Figure 2—figure supplement 4
CRY promotes wakefulness via GABA signaling.
(A, B) Sleep profile of male wild-type (WT) and cry mutant flies fed with nipecotic acid (NipA) (A) or EOS (B) under 4L20D in Figure 2E. White box indicates light period while black box indicates dark period. (C–E) Daily waking activity (C), sleep bout number (D), average sleep bout length (E) of male WT and cry mutant flies fed with NipA or EOS under 4L20D in Figure 2E. Two-tailed Student’s t-test: compared to WT, #p<0.05, ##p<0.01, ###p<0.001; compared to vehicle control, *p<0.05, **p<0.01, ***p<0.001. (F–I) Sleep profile (F), daily waking activity (G), sleep bout number (H), average sleep bout length (I) of cry RNAi and control flies fed with NipA under 4L20D in Figure 2F. One-way ANOVA with Bonferroni multiple comparison test: compared to GAL4 control, **p<0.01, ***p<0.001; compared to UAS control, #p<0.05, ##p<0.01, ###p<0.001. For comparing to vehicle control, two-tailed Student’s t-test was used, $p<0.05, $$p<0.01, $$$p<0.001. Error bars represent standard error of the mean (SEM). G4, GAL4; U, UAS.
Figure 2—figure supplement 5
CRY promotes wakefulness via GABA-related genes.
(A–D) Sleep profile (A), daily waking activity (B), sleep bout number (C), average sleep bout length (D) of male flies with cry and gad1 knocked down in GABAergic neurons monitored under 4L20D in Figure 2G. (E–H) Sleep profile (E), daily waking activity (F), sleep bout number (G), average sleep bout length (H) of male flies with cry and VGAT knocked down in GABAergic neurons monitored under 4L20D in Figure 2H. For comparison between RNAi flies vs. UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, *p<0.05, **p<0.01, ***p<0.001; compared to UAS control, #p<0.05, ##p<0.01, ###p<0.001. For comparing to RNAi control, two-tailed Student’s t-test was used: compared to UAScryRNAi/GAL4 control, $p<0.05, $$p<0.01, $$$p<0.001; compared to UASGad1RNAi/GAL4 or UVGATRNAi/GAL4 control, &&&p<0.001. (I–L) Sleep profile (I), daily waking activity (J), sleep bout number (K), average sleep bout length (L) of cry mutant flies with VGAT knocked down in GABAergic neurons monitored under 4L20D in Figure 2I. For comparison between RNAi flies vs. UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, *p<0.05, ***p<0.001; compared to UAS control, #p<0.05, ##p<0.01, ###p<0.001. For comparison between mutant vs. control, two-tailed Student’s t-test was used: compared to wild-type (WT) background, &p<0.05, &&p<0.01, &&&p<0.001. (M, N) Plots of relative mRNA abundance for Gad1 (M) and VGAT (N) determined by quantitative real-time PCR (qRT-PCR) in whole-head extracts of RNAi and control flies under 4L20D (n=6). The value of the GAL4 control group was set to 1. Mann-Whitney test: compared to GAL4 control, **p<0.01; compared to UAS control, ##p<0.01. (O) Daily sleep duration of male flies with cry and gfp knocked down in GABAergic neurons by Gad1GAL4 monitored under 4L20D (n=72, 26, 29, 20, 30, 31, 68, 32, 31, 29, 29). One-way ANOVA with Bonferroni multiple comparison test: compared to GAL4 control, ***p<0.001; compared to UAS control, #p<0.05, ###p<0.001. Error bars represent quantitative real-time PCR (SEM); G4, GAL4; U, UAS; NS, not significant.
Figure 3 with 3 supplements
GABA-A receptor mediates the effects of CRY on sleep/wakefulness.
(A, C, D) Daily sleep duration of male wild-type (WT) and cry mutant flies fed with THIP (A) (n=28, 29, 16, 19 flies), SKF-97541 (C) (n=25, 21, 23, 18 flies), or carbamazepine (CBZ) (D) (n=28, 25, 31, 29 flies) under 4L20D. Two-tailed Student’s t-test: compared to WT, ###p<0.001; compared to vehicle control, ***p<0.001. (B, E) Sleep profile of male WT and cry mutant flies fed with THIP (B) or CBZ (E) under 4L20D in A and D, respectively. White box indicates light period while black box indicates dark period. (F, H) Daily sleep duration of male cry RNAi and control flies fed with THIP (F) (n=32, 32, 32, 32, 29, 23, 30, 27, 27, 20 flies) or CBZ (H) (n=24, 16, 18, 22, 23, 18, 22, 26, 30, 24 flies) under 4L20D. For comparison between RNAi flies vs. UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, ***p<0.001; compared to UAS control, ##p<0.01, ###p<0.001. For comparing to vehicle control, two-tailed Student’s t-test was used, $$$p<0.001. (G, I) Sleep profile of male cry RNAi and control flies fed with THIP (G) or CBZ (I) under 4L20D in F and H, respectively. White box indicates light period while black box indicates dark period. (J) Daily sleep duration of male RdlMD-RR flies with cry knocked down in GABAergic neurons under 4L20D, along with relevant controls (n=72, 73, 66, 44, 45, 33, 45, 54, 38, 33 flies). For comparison between RNAi flies vs. UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, ***p<0.001; compared to UAS control, ###p<0.001. For comparing to WT or UAScryRNAi/GAL4 control, two-tailed Student’s t-test was used: compared to WT, &p<0.05; compared to UAScryRNAi/GAL4 control, $$$p<0.001. (K, L) Sleep profile of male RdlMD-RR flies with cry knocked down in GABAergic neurons using cryRNAi-1 (K) or cryRNAi-2 (L) under 4L20D in J. Error bars represent standard error of the mean (SEM); G4, GAL4; U, UAS.
-
Figure 3—source data 1
Numerical data with associated statistical analyses underlying Figure 3.
- https://cdn.elifesciences.org/articles/92608/elife-92608-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
GABA-A receptor mediates the effects of cry mutation on sleep/wakefulness.
(A–C) Daily waking activity (A), sleep bout number (B), average sleep bout length (C) of male wild-type (WT) and cry mutant flies fed with THIP under 4L20D in Figure 3A. (D–F) Daily waking activity (D), sleep bout number (E), average sleep bout length (F) of male WT and cry mutant flies fed with SKF-97541 under 4L20D in Figure 3C. (G–I) Daily waking activity (G), sleep bout number (H), average sleep bout length (I) of male WT and cry mutant flies fed with carbamazepine (CBZ) under 4L20D in Figure 3D. Two-tailed Student’s t-test: compared to WT, #p<0.05, ##p<0.01, ###p<0.001; compared to vehicle control, *p<0.05, **p<0.01, ***p<0.001. Error bars represent standard error of the mean (SEM).
Figure 3—figure supplement 2
GABA-A receptor mediates the effects of cry RNAi flies on sleep/wakefulness.
(A–C) Daily waking activity (A), sleep bout number (B), average sleep bout length (C) of male cry RNAi and control flies fed with THIP under 4L20D in Figure 3F. (D–F) Daily waking activity (D), sleep bout number (E), average sleep bout length (F) of male cry RNAi and control flies fed with CBZ under 4L20D in Figure 3H. For comparison between RNAi flies vs. UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, *p<0.05, **p<0.01, ***p<0.001; compared to UAS control, #p<0.05, ##p<0.01. For comparing to vehicle control, two-tailed Student’s t-test was used, $p<0.05, $$p<0.01, $$$p<0.001. Error bars represent standard error of the mean (SEM). G4, GAL4; U, UAS.
Figure 3—figure supplement 3
GABA-A receptor mediates the effects of cry RNAi flies on sleep/wakefulness.
(A–C) Daily waking activity (A), sleep bout number (B), average sleep bout length (C) of male RdlMD-RR flies with cry knocked down in GABAergic neurons under 4L20D in Figure 3J. For comparison between RNAi flies vs. UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, **p<0.01, ***p<0.001; compared to UAS control, #p<0.05, ##p<0.01, ###p<0.001. For comparing to wild-type (WT) or UAScryRNAi/GAL4 control, two-tailed Student’s t-test was used: compared to WT, &p<0.05; &&&p<0.001; compared to UAScryRNAi/GAL4 control, $$p<0.01, $$$p<0.001. Error bars represent standard error of the mean (SEM). G4, GAL4; U, UAS.
Figure 4 with 3 supplements
CRY increases the neural activity of the large ventral lateral neurons (l-LNvs) to promote wakefulness.
(A–D) Brains from male wild-type (WT) and cry mutant flies dissected at ZT1, 7, 13, 19 under 4L20D (A) or 12L12D (C) are immunostained with GABA (cyan) and pigment dispersing factor (PDF) (magenta) antisera, and representative l-LNvs are displayed. Merged signal is shown as white. Bar graphs represent normalized GABA intensity in the l-LNvs under 4L20D (B) (n=26–56 cells) and 12L12D (D) (n=32–128 cells). The average value of the control group at ZT1 is set to 1. (E) Representative live image of the l-LNvs expressing GCaMP6m and tdTomato using PdfGAL4. Brain samples are dissected at the indicated time points under 4L20D. (F) Quantification of GCaMP6m signal intensity normalized to that of tdTomato (n=25–54 cells). Student’s t-test: *p<0.05, **p<0.01, ***p<0.001. (G) Daily sleep duration of male flies expressing Kir2.1 in PDF neuron using PdfGAL4 and controls, monitored under 4L20D (n=32, 42, 30 flies). One-way ANOVA with Bonferroni multiple comparison test: compared to GAL4 control, *p<0.05; compared to UAS control, ###p<0.001. (H, I) Daily sleep duration of male cry mutant flies expressing TrpA1 in the l-LNvs using c929GAL4 (H) (n=42, 42, 38, 35, 45, 37 flies) or R10H10GAL4 (I) (n=62, 62, 17, 30, 29, 30 flies) and relevant controls, monitored under 4L20D and 29°C to activate TrpA1. For comparison with UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, ***p<0.001; compared to UAS control, ###p<0.001. For comparison between mutant vs. control, two-tailed Student’s t-test was used: &p<0.05, &&&p<0.001. (J, K) Daily sleep duration of cry mutant flies expressing NachBac in the l-LNvs using c929GAL4 (J) (n=45, 30, 32, 48, 55, 48 flies) or R10H10GAL4 (K) (n=25, 59, 29, 74, 25, 32 flies) and relevant controls, monitored under 4L20D. For comparison with UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, *p<0.05, ***p<0.001; compared to UAS control, ###p<0.001. For comparison between mutant vs. control, two-tailed Student’s t-test was used: &p<0.05, &&&p<0.001. (L, M) Daily sleep duration of male Pdf01-cryb (L) (n=58, 91, 89, 31 flies) and Pdfrhan5304;cryb (M) (n=58, 91, 31, 31 flies) mutants along with relevant controls, monitored under 4L20D. Two-tailed Student’s t-test: compared to WT background, ***p<0.001; compared to Pdf01or Pdfrhan5304, ###p<0.001; compared to cryb, &&p<0.01, &&&p<0.001. The scale bar represents 15 µm. Error bars represent standard error of the mean (SEM). G4, GAL4; U, UAS.
-
Figure 4—source data 1
Numerical data with associated statistical analyses underlying Figure 4.
- https://cdn.elifesciences.org/articles/92608/elife-92608-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
GABAergic neurons project to and form synapses with the large ventral lateral neurons (l-LNvs).
(A) l-LNvs of flies expressing syt-GFP in GABAergic neurons using Gad1Gal4 maintained under 4L20D and immunostained with pigment dispersing factor (PDF) antisera. (B) l-LNvs of flies expressing Pre-mGRASP in GABAergic neurons using Gad1Gal4 and t-GRASP in the l-LNvs using PdfLexA maintained under 4L20D. Brains are immunostained with PDF antisera. (C) l-LNvs of flies expressing trans-Tango in GABAergic neurons using Gad1Gal4 maintained under 4L20D and immunostained with HA and PDF antisera. (D) Daily sleep duration of cry mutant flies with Rdl knocked down in the l-LNvs using R78G01GAL4 and relevant controls, monitored under 4L20D (n=31, 31, 64, 32, 31, 32 flies). For comparison between RNAi flies vs. UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, *p<0.05; compared to UAS control, ###p<0.001. For comparison between mutant vs. control, two-tailed Student’s t-test was used: compared to wild-type (WT) background, &p<0.05, &&&p<0.001; compared to URdlRNAi/GAL4, not significant. The scale bar represents 15 µm. Error bars represent standard error of the mean (SEM). G4, GAL4; U, UAS; LexAop, LexA operator.
Figure 4—figure supplement 2
CRY promotes wakefulness by impinging on the excitability of large ventral lateral neuron (l-LNv).
(A–D) Sleep profile (A), daily waking activity (B), sleep bout number (C), average sleep bout length (D) of male flies expressing Kir2.1 in pigment dispersing factor (PDF) neuron using PdfGAL4 and controls, monitored under 4L20D in Figure 4G. White box indicates light period while black box indicates dark period. (E–H) Sleep profile (E), daily waking activity (F), sleep bout number (G), average sleep bout length (H) of male cry mutant flies expressing TrpA1 in the l-LNvs using c929GAL4 and relevant controls in Figure 4H, monitored under 4L20D and 29°C to activate TrpA1. (I–L) Sleep profile (I), daily waking activity (J), sleep bout number (K), average sleep bout length (L) of male cry mutant flies expressing TrpA1 in the l-LNvs using R10H10GAL4 and relevant controls in Figure 4I, monitored under 4L20D and 29°C to activate TrpA1. For comparison with UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, *p<0.05, **p<0.01, ***p<0.001; compared to UAS control, #p<0.05, ##p<0.01, ###p<0.001. For comparison between mutant vs. control, two-tailed Student’s t-test was used: &p<0.05, &&p<0.01, &&&p<0.001. (M–P) Sleep profile (M), daily waking activity (N), sleep bout number (O), average sleep bout length (P) of cry mutant flies expressing NachBac in the l-LNvs using c929GAL4 and relevant controls in Figure 4J, monitored under 4L20D. (Q–T) Sleep profile (Q), daily waking activity (R), sleep bout number (S), average sleep bout length (T) of cry mutant flies expressing NachBac in the l-LNvs using R10H10GAL4 and relevant controls in Figure 4K, monitored under 4L20D. For comparison with UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, **p<0.01, ***p<0.001; compared to UAS control, #p<0.05, ###p<0.001. For comparison between mutant vs. control, two-tailed Student’s t-test was used: &p<0.05, &&p<0.01, &&&p<0.001. Error bars represent standard error of the mean (SEM). G4, GAL4; U, UAS.
Figure 4—figure supplement 3
CRY promotes wakefulness by impinging on pigment dispersing factor (PDF) signaling.
(A–D) Sleep profile (A), daily waking activity (B), sleep bout number (C), average sleep bout length (D) of male Pdf01-cryb mutants along with relevant controls in Figure 4L, monitored under 4L20D. (E–H) Sleep profile (E), daily waking activity (F), sleep bout number (G), average sleep bout length (H) of male Pdfrhan5304;cryb mutants along with relevant controls in Figure 4M, respectively, monitored under 4L20D. Two-tailed Student’s t-test: compared to wild-type (WT) background, **p<0.01, ***p<0.001; compared to Pdf01or Pdfrhan5304, ##p<0.01, ###p<0.001; compared to cryb, &&&p<0.001. Error bars represent SEM.
Figure 5 with 4 supplements
CRY acts in the small ventral lateral neurons (s-LNvs) to inhibit their neural activity and promote wakefulness.
(A) Brains of male flies expressing nls-GFP driven by Gad1GAL4 maintained under 4L20D and immunostained with pigment dispersing factor (PDF) antisera. Representative l-LNv and s-LNv are displayed. (B) Quantification of GFP signal intensity of PDF neuron (n=20, 49, 43 cells). Two-tailed Student’s t-test: ***p<0.001. (C) Daily sleep duration of flies with cry knocked down in the s-LNvs using R6GAL4 and relevant controls, monitored under 4L20D (n=45, 60, 63, 34, 39 flies). (D–G) Brains from male wild-type (WT) and cry mutant flies dissected at ZT1, 7, 13, 19 under 4L20D (D) or 12L12D (F) are immunostained with GABA (cyan) and PDF (magenta) antisera, and representative s-LNvs are displayed. Merged signal is shown as white. Bar graphs represent normalized GABA intensity in the s-LNvs under 4L20D (E) (n=20–53 cells) and 12L12D (G) (n=29–67 cells). The average value of the control group at ZT1 is set to 1. (H) Representative live image of the s-LNvs expressing GCaMP6m and tdTomato using PdfGAL4. Brain samples are dissected at the indicated time points under 4L20D. (I) Quantification of GCaMP6m signal intensity normalized to that of tdTomato (n=29–47 cells). Two-tailed Student’s t-test: *p<0.05, **p<0.01, ***p<0.001. (J) Daily sleep duration of male flies expressing TrpA1 in the s-LNvs using R6GAL4 and relevant controls, monitored under 4L20D and 29°C to activate TrpA1 (n=45, 54, 29, 22, 56, 22 flies). (K) Daily sleep duration of male cry mutant flies expressing TrpA1 in the s-LNvs using R6GAL4 and relevant controls, monitored under 4L20D and 29°C to activate TrpA1 (n=33, 42, 23, 35, 36, 20 flies). (L) Daily sleep duration of male cry mutant flies overexpressing HK in the s-LNvs using R6GAL4 and relevant controls, monitored under 4L20D (n=24, 29, 23, 30, 37, 22 flies). For comparison with UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, *p<0.05, ***p<0.001; compared to UAS control, ##p<0.01, ###p<0.001. For comparison between mutant vs. control, two-tailed Student’s t-test was used: compared to WT background, &&p<0.01, &&&p<0.001. The scale bar represents 15 µm. Error bars represent standard error of the mean (SEM). G4, GAL4; U, UAS; NS, not significant.
-
Figure 5—source data 1
Numerical data with associated statistical analyses underlying Figure 5.
- https://cdn.elifesciences.org/articles/92608/elife-92608-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
Gad1GAL4 drives expression in the small ventral lateral neurons (s-LNvs) but not large ventral lateral neurons (l-LNvs).
(A) Brains of male flies expressing nls-GFP driven by Gad1GAL4 maintained under 4L20D and immunostained with pigment dispersing factor (PDF) antisera. (B) Quantification of GFP signal intensity of PDF neuron (n=15, 18, 25 cells). Two-tailed Student’s t-test: ***p<0.001. (C) Brains of male flies expressing nls-GFP in GABAergic neurons using Gad1Gal4 and rCD2-RFP in the PDF neurons using PdfLexA maintained under 4L20D. (D) Quantification of GFP signal intensity of PDF neuron (n=18, 22, 21 cells). Two-tailed Student’s t-test: ***p<0.001. The scale bar represents 15 µm.
Figure 5—figure supplement 2
cry expression in the small ventral lateral neurons (s-LNvs) is necessary but not sufficient for maintaining normal sleep/wakefulness.
(A–D) Sleep profile (A), daily waking activity (B), sleep bout number (C), average sleep bout length (D) of cry knocked down in s-LNvs by R6GAL4 monitored under 4L20D in Figure 5C. White box indicates light period while black box indicates dark period. (E) Daily sleep duration of cry knocked down in pigment dispersing factor (PDF)-GABAergic neurons using Gad1GAL4 and PdfGAL80, monitored under 4L20D (n=101, 26, 29, 27, 31, 23, 32, 73, 63). One-way ANOVA with Bonferroni multiple comparison test: compared to GAL4 control, *p<0.05, **p<0.01, ***p<0.001; compared to UAS control, #p<0.05, ###p<0.001. Error bars represent standard error of the mean (SEM). G4, GAL4; G80, GAL80; U, UAS.
Figure 5—figure supplement 3
Small ventral lateral neurons (s-LNvs) appear to be GABAergic neurons.
(A) Brains from male flies with VGAT knocked down in the s-LNvs using R6GAL4 and control maintained under 4L20D and immunostained with GABA (cyan) and pigment dispersing factor (PDF) (magenta) antisera. Representative s-LNvs are displayed. Merged signal is shown as white. (B) Bar graphs represent normalized GABA intensity in the s-LNvs with VGAT knocked down using R6GAL4 (n=25, 32 cells). The average value of the control group is set to 1. Two-tailed Student’s t-test, ***p<0.001. The scale bar represents 15 µm. Error bars represent standard error of the mean (SEM). G4, GAL4; U, UAS.
Figure 5—figure supplement 4
CRY promotes wakefulness by impinging on the excitability of the small ventral lateral neurons (s-LNvs).
(A–D) Sleep profile (A), daily waking activity (B), sleep bout number (C), average sleep bout length (D) of male flies expressing TrpA1 in the s-LNvs using R6GAL4 and relevant controls in Figure 5J, monitored under 4L20D and 29°C to activate TrpA1. White box indicates light period while black box indicates dark period. (E–H) Sleep profile (E), daily waking activity (F), sleep bout number (G), average sleep bout length (H) of male cry mutant flies expressing TrpA1 in the s-LNvs using R6GAL4 and relevant controls in Figure 5K, monitored under 4L20D and 29°C to activate TrpA1. (I–L) Sleep profile (I), daily waking activity (J), sleep bout number (K), average sleep bout length (L) of male cry mutant flies overexpressing HK in the s-LNvs using R6GAL4 and relevant controls in Figure 5L, monitored under 4L20D. For comparison with UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, *p<0.05, **p<0.01, ***p<0.001; compared to UAS control, ##p<0.01, ###p<0.001. For comparison between mutant vs. control, two-tailed Student’s t-test was used: compared to wild-type (WT) background, &p<0.05, &&p<0.01, &&&p<0.001. Error bars represent standard error of the mean (SEM). G4, GAL4; G80, GAL80; U, UAS.
Figure 6 with 1 supplement
Small ventral lateral neurons (s-LNvs) release GABA onto the large ventral lateral neurons (l-LNvs).
(A) l-LNvs of male flies expressing syt-GFP in the s-LNvs using R6GAL4 maintained under 4L20D and immunostained with pigment dispersing factor (PDF) antisera. (B) l-LNvs of male flies expressing trans-Tango in the s-LNvs using R6GAL4 maintained under 4L20D and immunostained with HA and PDF antisera. (C) Brains from male flies with VGAT (top) or Gad1 (bottom) knocked down in the s-LNvs using R6GAL4 and controls maintained under 4L20D and immunostained with GABA (cyan) and PDF (magenta) antisera. Representative l-LNvs are displayed. Merged signal is shown as white. (D, E) Bar graphs represent normalized GABA intensity in the l-LNvs of flies with VGAT (D) (n=29, 37 cells) or Gad1 (E) (n=37, 51 cells) knocked down in the s-LNvs using R6GAL4, monitored under 4L20D. The average value of the control group is set to 1. Two-tailed Student’s t-test: **p<0.01, ***p<0.001. (F) Daily sleep duration of male cry mutant flies with VGAT knocked down in the s-LNvs using R6GAL4 and relevant controls, monitored under 4L20D (n=31, 31, 32, 29, 43, 19 flies). For comparison between RNAi flies vs. UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, *p<0.05, **p<0.01; compared to UAS control, ###p<0.01. For comparison between mutant vs. control, two-tailed Student’s t-test was used: compared to wild-type (WT) background, &&&p<0.001. (G) Sleep profile of male cry mutant flies with VGAT knocked down in the s-LNvs using R6GAL4 and relevant controls in F, monitored under 4L20D. (H) Daily sleep duration of male cry mutant flies with Gad1 knocked down in the s-LNvs using R6GAL4 and relevant controls, monitored under 4L20D (n=59, 59, 53, 60, 62, 45 flies). For comparison between RNAi flies vs. UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, *p<0.05, **p<0.01, ***p<0.001; compared to UAS control, #p<0.05, ##p<0.01. For comparison between mutant vs. control, two-tailed Student’s t-test was used: compared to WT background, &&&p<0.001. (I) Sleep profile of male cry mutant flies with Gad1 knocked down in the s-LNvs using R6GAL4 and relevant controls in H, monitored under 4L20D. The scale bar represents 15 µm. Error bars represent standard error of the mean (SEM). G4, GAL4; U, UAS; NS, not significant.
-
Figure 6—source data 1
Numerical data with associated statistical analyses underlying Figure 6.
- https://cdn.elifesciences.org/articles/92608/elife-92608-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
Knocking down VGAT or Gad1 suppresses the long-sleep phenotype of cry mutation.
(A–C) Daily waking activity (A), sleep bout number (B), average sleep bout length (C) of male cry mutant flies with VGAT knocked down in the small ventral lateral neurons (s-LNvs) using R6GAL4 and relevant controls in Figure 6F, monitored under 4L20D. (D–F) Daily waking activity (D), sleep bout number (E), average sleep bout length (F) of male cry mutant flies with Gad1 knocked down in the s-LNvs using R6GAL4 and relevant controls in Figure 6H, monitored under 4L20D. For comparison between RNAi flies vs. UAS/GAL4 controls, one-way ANOVA with Bonferroni multiple comparison test was used: compared to GAL4 control, ***p<0.001; compared to UAS control, #p<0.05, ##p<0.01, ###p<0.001. For comparison between mutant vs. control, two-tailed Student’s t-test was used: compared to wild-type (WT) background, &&p<0.01, &&&p<0.001. Error bars represent standard error of the mean (SEM). G4, GAL4; U, UAS.
Figure 7
Short photoperiod reduces GABA level at the large ventral lateral neurons (l-LNvs) and increases sleep duration.
(A–D) Brains from male wild-type (WT) flies dissected at ZT1, 7, 13, 19 under 4L20D or 12L12D are immunostained with GABA (cyan) and pigment dispersing factor (PDF) (magenta) antisera. Representative l-LNvs (A) and small ventral lateral neurons (s-LNvs) (C) are displayed. Merged signal is shown as white. Bar graphs represent normalized GABA intensity in the l-LNvs (B) (n=28–55 cells) and s-LNvs (D) (n=21–59 cells). The average value of the control group at ZT1 is set to 1. Student’s t-test: ***p<0.001. (E–I) The daily sleep duration (E), sleep bout number (F), average sleep bout length (G), waking activity (H), and sleep profile (I) of male WT flies under 4L20D and 12L12D (n=91, 32 flies). Two-tailed Student’s t-test: ***p<0.001. The scale bar represents 15 µm. Error bars represent SEM. (J) A model demonstrating how CRY regulates the GABAergic s-LNv/l-LNv circuitry under short vs. longer photoperiods to promote arousal.
-
Figure 7—source data 1
Numerical data with associated statistical analyses underlying Figure 7.
- https://cdn.elifesciences.org/articles/92608/elife-92608-fig7-data1-v1.xlsx
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (D. melanogaster) | Isogenic w1118 | Bloomington Drosophila Stock Center | RRID:BDSC_5905 | |
| Genetic reagent (D. melanogaster) | cryb | Bloomington Drosophila Stock Center | RRID:BDSC_80921 | |
| Genetic reagent (D. melanogaster) | per0 | Bloomington Drosophila Stock Center | RRID:BDSC_80917 | |
| Genetic reagent (D. melanogaster) | tim0 | Bloomington Drosophila Stock Center | RRID:BDSC_80922 | |
| Genetic reagent (D. melanogaster) | clkjrk | Bloomington Drosophila Stock Center | RRID:BDSC_80927 | |
| Genetic reagent (D. melanogaster) | cyc0 | Bloomington Drosophila Stock Center | RRID:BDSC_80929 | |
| Genetic reagent (D. melanogaster) | Pdf01 | Bloomington Drosophila Stock Center | RRID:BDSC_26654 | |
| Genetic reagent (D. melanogaster) | Pdfrhan5304 | Bloomington Drosophila Stock Center | RRID:BDSC_33068 | |
| Genetic reagent (D. melanogaster) | RdlMD-RR | Bloomington Drosophila Stock Center | RRID:BDSC_1675 | |
| Genetic reagent (D. melanogaster) | cry03 | PMID:17720919 | FlyBase symbol:TI{TI}cry03 | |
| Genetic reagent (D. melanogaster) | UAS-hk | Bloomington Drosophila Stock Center | RRID:BDSC_86270 | |
| Genetic reagent (D. melanogaster) | UAS-NachBac | Bloomington Drosophila Stock Center | RRID:BDSC_9469 | |
| Genetic reagent (D. melanogaster) | UAS-TrpA1 | Bloomington Drosophila Stock Center | RRID:BDSC_26263 | |
| Genetic reagent (D. melanogaster) | UAS-Kir2.1 | Bloomington Drosophila Stock Center | RRID:BDSC_6596 | |
| Genetic reagent (D. melanogaster) | UAS-sytGFP | Bloomington Drosophila Stock Center | RRID:BDSC_6925 | |
| Genetic reagent (D. melanogaster) | UAS-nlsGFP | Bloomington Drosophila Stock Center | RRID:BDSC_4775 | |
| Genetic reagent (D. melanogaster) | UAS-myrGFP, QUAS-mtdTomato(3XHA); trans-tango | Bloomington Drosophila Stock Center | RRID:BDSC_77480 | |
| Genetic reagent (D. melanogaster) | 13XLexAop2-post-t-GRASP, 20XUAS-pre-mGRASP | Bloomington Drosophila Stock Center | RRID:BDSC_79040 | |
| Genetic reagent (D. melanogaster) | LexAop-rCD2-RFP | PMID:24012007 Perisse et al., 2013 | ||
| Genetic reagent (D. melanogaster) | UAS-cryRNAi-1 | TsingHua Fly Center | THU4761 | |
| Genetic reagent (D. melanogaster) | UAS-cryRNAi-2 | TsingHua Fly Center | THU5148 | |
| Genetic reagent (D. melanogaster) | UAS-gad1RNAi-1 | TsingHua Fly Center | THU2920 RRID:BDSC_28079 | |
| Genetic reagent (D. melanogaster) | UAS-VGATRNAi-1 | TsingHua Fly Center | THU4303 RRID:BDSC_41955 | |
| Genetic reagent (D. melanogaster) | UAS-VGATRNAi-2 | Vienna Drosophila Resource Center | V45916 RRID:Flybase_FBst0466419 | |
| Genetic reagent (D. melanogaster) | UAS-GCaMP6m-tdTomato | PMID:23868258 | ||
| Genetic reagent (D. melanogaster) | Pdf-LexA | PMID:19060186 | ||
| Genetic reagent (D. melanogaster) | PdfGAL4 | Bloomington Drosophila Stock Center | RRID:BDSC_6899 | |
| Genetic reagent (D. melanogaster) | VGATGAL4 | Bloomington Drosophila Stock Center | RRID:BDSC_58980 | |
| Genetic reagent (D. melanogaster) | Gad1GAL4-1 | PMID:30799021 | ||
| Genetic reagent (D. melanogaster) | Gad1GAL4-2 | Bloomington Drosophila Stock Center | RRID:BDSC_51630 | |
| Genetic reagent (D. melanogaster) | Dop2RGAL4 | PMID:30799021 | ||
| Genetic reagent (D. melanogaster) | THGAL4 | PMID:30799021 | ||
| Genetic reagent (D. melanogaster) | TrhGAL4 | PMID:30799021 | ||
| Genetic reagent (D. melanogaster) | AdoRGAL4 | PMID:30799021 | ||
| Genetic reagent (D. melanogaster) | DATGAL4 | PMID:30799021 | ||
| Genetic reagent (D. melanogaster) | GABAR1GAL4 | PMID:30799021 | ||
| Genetic reagent (D. melanogaster) | GABAR3GAL4 | PMID:30799021 | ||
| Genetic reagent (D. melanogaster) | SerTGAL4 | PMID:30799021 | ||
| Genetic reagent (D. melanogaster) | GluRIAGAL4 | PMID:30799021 | ||
| Genetic reagent (D. melanogaster) | R6GAL4 | PMID:17099895 | FlyBase symbol:P{GawB}crcR6 | |
| Genetic reagent (D. melanogaster) | c929GAL4 | PMID:18365028 Park et al., 2008 | FlyBase symbol:P{GawB}crcc929 | |
| Genetic reagent (D. melanogaster) | R10H10GAL4 | Bloomington Drosophila Stock Center PMID:31856635 Sekiguchi et al., 2020 | RRID:BDSC_48445 | |
| Genetic reagent (D. melanogaster) | R78G01GAL4 | Bloomington Drosophila Stock Center | RRID:BDSC_40009 | |
| Genetic reagent (D. melanogaster) | PdfGAL80 | PMID:15483615 | ||
| Antibody | Anti-PDF (mouse monoclonal) | Developmental Studies Hybridoma Bank (DSHB) | Cat#PDF C7; RRID:AB_760350 | IF (1:100) |
| Antibody | Anti-GABA (rabbit polyclonal) | Sigma | Cat#A2052; RRID:AB_477652 | IF (1:200) |
| Antibody | Anti-HA (mouse monoclonal) | DSHB | Cat#anti-HA rRb-IgG; RRID:AB_3105929 | IF (1:100) |
| Antibody | Alexa Fluor 594 (mouse polyclonal) | Life Technologies | Cat#A-11005; RRID:AB_2534073 | IF (1:1000) |
| Antibody | Alexa Fluor 488 (rabbit polyclonal) | Abcam | Cat#ab150077; RRID:AB_2630356 | IF (1:1000) |
| Antibody | Alexa Fluor 647 (rabbit polyclonal) | Abcam | Cat#ab150075; RRID:AB_2752244 | IF (1:1000) |
| Sequence-based reagent | cry_F | This paper | PCR primers | TGCAGGTACCAAGAATGTGG |
| Sequence-based reagent | cry_R | This paper | PCR primers | GTCCACGTCCATCAGTTGC |
| Sequence-based reagent | Gad1_F | This paper | PCR primers | TGCCACCACATTGAAGTACC |
| Sequence-based reagent | Gad1_R | This paper | PCR primers | GGTGAACATGTTGGTGTTCG |
| Sequence-based reagent | VGAT_F | This paper | PCR primers | ACGGCTTTAGGCAAGGTAGC |
| Sequence-based reagent | VGAT_R | This paper | PCR primers | TTGGAATTCGTCGATTTTGC |
| Chemical compound, drug | Nipecotic acid | Sigma | Cat#211672 | 10 mg/ml |
| Chemical compound, drug | EOS | Sigma | Cat#06720 | 10 mM |
| Chemical compound, drug | THIP | Sigma | Cat#T101 | 10 µg/ml |
| Chemical compound, drug | SKF-97541 | Tocris | Cat#0379 | 10 µg/ml |
| Chemical compound, drug | CBZ | Sinopharm Chemical Reagent | Cat#298-46-4 | 0.15 mg/ml |
| Software, algorithm | ImageJ | NIH | RRID:SCR_002285 | |
| Software, algorithm | Drosophila Activity Monitor system | TriKinetics | RRID:SCR_021798 | Counting Macro |
| Software, algorithm | GraphPad Prism 8.0 | GraphPad Software | RRID:SCR_002798 | https://www.graphpad.com/scientific-software/prism/ |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Circadian photoreceptor CRYPTOCHROME promotes wakefulness under short winter-like days via a GABAergic circuitry
eLife 12:RP92608.
https://doi.org/10.7554/eLife.92608.4
