The type VI secretion system governs strain maintenance in a wild mammalian gut microbiome
- Department of Microbiology, University of Washington, United States
- Microbial Interactions & Microbiome Center, University of Washington, United States
- Department of Microbial Pathogenesis and Microbial Sciences Institute, Yale University School of Medicine, United States
- Bioinformatics Core, Fred Hutchinson Cancer Center, United States
- Department of Laboratory Medicine and Pathology, University of Washington, United States
- Department of Genomic Medicine, The University of Texas MD Anderson Cancer Center Houston, United States
- Howard Hughes Medical Institute, University of Washington, United States
Figures
Figure 1 with 1 supplement
The WildR murine gut microbiome is stable over multiple generations and harbors an ICE-encoded T6SS.
(A) Phylum-level taxonomic composition of the WildR or lab-derived murine gut microbiome at different generations. Data from the initial wild-caught donor mice (Wild), the WildR F2 generation, and the lab mice-derived community derive from new analysis of previously published sequencing data (Rosshart et al., 2017). WildR F7 data derives from two cryopreserved samples of pooled ilocecal contents (labeled A and B) and fecal pellets from two mice (numbers 1 and 2) used to propagate the community; *indicates technical duplicate samples included in WildR F7 sequencing. (B–E) Comparison of the abundance of the 100 genera most prevalent in wild donor mice between the indicated communities. Points are shaded to show overlapping datapoints (darker shades), and Spearman’s correlation for each comparison is indicated (ρ). ND, not detected. (F) To-scale schematic depicting the Bacteroides acidifaciens T6SS gene cluster. (G) Bioinformatic domain predictions for T6SS effector and immunity proteins of B. acidifaciens. Conserved amino acids are indicated in bold.
-
Figure 1—source data 1
Order-level abundance (percentage) in WildR microbiome generations based on Kraken2 analysis.
- https://cdn.elifesciences.org/articles/110200/elife-110200-fig1-data1-v1.xlsx
-
Figure 1—source data 2
Genus abundance data in WildR microbiome generations.
- https://cdn.elifesciences.org/articles/110200/elife-110200-fig1-data2-v1.xlsx
Figure 1—figure supplement 1
Evidence supporting stability of the WildR microbiome over multiple generations and identification of an ICE-encoded T6SS.
(A) Schematic depicting the generation of the WildR F7 cryopreserved stocks from the combined cecal contents of six mice used to propagate the community and subsequent community characterization steps. (B, C) Comparison of the abundance of the 100 genera most prevalent in wild donor mice between the indicated communities. Points are shaded to show overlapping datapoints (darker shades), and Spearman’s correlation for each comparison is indicated (ρ). ND, not detected. (D) Mapping efficiency of metagenomic reads from different WildR community generations to selected murine-derived genome databases: the WildR catalog (86 MAGs and genomes from the WildR, generated in this study) or the comprehensive mouse microbiota genome catalog (CMMG; 1573 species across mouse microbiomes; Kieser et al., 2022). (E) To-scale schematic of the ICE containing the GA1 T6SS encoded in B. acidifaciens and B. caecimuris F12. Location of single base deletion in B. caecimuris F12 highlighted in the orange box.
Figure 2 with 1 supplement
The B. acidifaciens T6SS intoxicates other WildR Bacteroidales species.
(A) Normalized growth yield (final/initial CFU, mean ± SD) of the indicated strains of B. acidifaciens (recipients) after in vitro growth in competition with B. acidifaciens wild-type or ΔtssC (donors). Data are representative of at least three biological replicates. *p ≤ 0.05 (two-tailed t-test). CFU, colony-forming units; bae, e; bai, i. (B) Mean (± SD) relative fitness of wild-type B. acidifaciens relative to a ΔtssC derivative during in vitro growth competition assays with the indicated species isolated from the WildR community. Data represent three biological replicates. *indicates the T6SS is significantly important for competitiveness (unpaired two-tailed t-test. p < 0.05). (C) Abundance (% reads per kilobase per million) of WildR species in two initial wild-caught donor mice used to establish the WildR (Rosshart et al., 2017). (D) Abundance of B. acidifaciens Δbae1 Δbai1 Δbae2 Δbai2 in mouse fecal samples collected following co-gavage of germ-free mice with this strain and wild-type or T6SS-inactivated (ΔtssC) B. acidifaciens. ND, not detected. *p < 0.05 (mixed-model ANOVA with repeated measures and Šidák’s multiple comparisons tests). (E) Relative abundance (compared to total Bacteroides) of B. caecimuris F5 following co-gavage of germ-free mice with B. acidifaciens wild-type or ΔtssC. *p < 0.05 (two-way ANOVA with repeated measures and Šidák’s multiple comparisons tests). For D and E, n = 6 mice from two independent replicates. Boxplots represent the interquartile range and mean for each condition; whiskers represent minimum and maximum detectable values; points represent individual values.
-
Figure 2—source data 1
Bacterial population quantification data.
- https://cdn.elifesciences.org/articles/110200/elife-110200-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Activity of the B. acidifaciens T6SS against species co-resident in the WildR community.
(A) In vitro mating efficiency of the integrative plasmid pNBU2-ermG:: tssC into B. acidifaciens. ‘RM silent’ indicates plasmid was mutated to remove a B. acidifaciens methylated motif. Data shown are mean ± SD from 3 independent matings. N.D., not detected; D.L., detection limit. (B) Recipient abundance after in vitro growth competitions between B. acidifaciens donors lacking various structural components of the T6SS and the indicated recipient species. (C) Competitive index from in vitro growth competition between indicated WildR isolates (recipient) and B. acidifaciens donors. For B and C, data show the mean ± SD of technical replicates from one biological replicate and represent results from at least three biological replicates. *p ≤ 0.05 by two-tailed t-test; all other comparisons were not significant. (D) B. caecimuris F5 abundance in cecal contents from germ-free mice co-colonized with B. acidifaciens wild-type or ΔtssC. Data show the mean ± SD and points indicate values from individual mice (n=6) across two biological replicates. *p ≤ 0.05 (two-tailed t-test). (E) P. vulguatus abundance in feces from germ-free mice (n = 6, two biological replicates) co-colonized with B. acidifaciens wild-type or ΔtssC and P. vulguatus. Boxplots represent the interquartile range with indicated mean for each condition; whiskers represent minimum and maximum values; points represent individual values. *p ≤ 0.05 (two-way ANOVA with repeated measures test and Šidák’s multiple comparisons test). (F) P. vulguatus abundance in cecal contents from mice described in panel E. Data show the mean ± SD and points show values from individual mice (n = 6). No statistical difference was found based on B. acidifaciens genotype by two-tailed t-test. (G) Relative abundance (% reads per kb per million) of selected WildR Bacteroidales species in the WildR F7 generation. Data are mean + SD from cryopreserved WildR stocks and two fecal samples from mice used to propagate the WildR F7 community.
Figure 3 with 1 supplement
Maintenance of B. acidifaciens in the WildR community is mediated by the T6SS.
(A) Schematic of approach to exploit the carrying capacity of the mouse gut to promote modified strain engraftment during WildR microbiome establishment without affecting community structure. Left, design of proof-of-concept experiment to evaluate the effect of increasing the amount of B. acidifaciens relative to the amount of the WildR microbiome during oral gavage. Right, design of experiment to evaluate the importance of the T6SS for B. acidifaciens fitness in the WildR microbiome-colonized mouse gut. Analysis of total (B), or introduced (C, D) B. acidifaciens populations in gavage (day 0) or post-gavage fecal samples from germ-free mice colonized with the WildR and variable levels of B. acidexo. (B) Total abundance of B. acidifaciens calculated from sequencing 16S rRNA genes amplified from DNA extracted from fecal samples. Differences in B. acidifaciens abundance across mice gavaged with different amounts of B. acidexo were not significant (n = 4 mice/sample, mixed-effects analysis). (C) Relative abundance of B. acidexo in the indicated fecal samples compared to total B. acidifaciens as determined by qPCR. (D) Abundance of B. acidexo in the indicated fecal samples as determined by plating for CFU on selective media. (E) Principal coordinate analysis of weighted Unifrac diversity metrics calculated from 16S rRNA gene amplicon sequencing data from feces collected from mice colonized with the WildR and variable amounts of B. acidexo. Quantification of B. acidexo (F, G) or total (H) B. acidifaciens population in gavage (day 0) and post-gavage fecal samples from germ-free mice colonized with the WildR community and 10-fold excess wild-type or ΔtssC B. acidexo. n = 8 mice per strain, across two biological replicates. (F) CFU quantification of B. acidexo and B. acidexo ΔtssC. *p ≤ 0.05 (two-way ANOVA with repeated measures and Šidák’s multiple comparisons test). (G) Abundance of B. acidexo or B. acidexo ΔtssC relative to the total B. acidifaciens population, as determined by qPCR. *p ≤ 0.05 (two-way ANOVA with repeated measures and Šidák’s multiple comparisons test). (H) Total abundance of B. acidifaciens, calculated from 16S rRNA gene amplicon sequencing. Samples from mice colonized by the WildR community alone (no B. acidexo, white bars) are included for comparison. Differences in B. acidifaciens abundance based on B. acidexo genotype were not significant (mixed-model ANOVA test). For panels B–D and F–H, boxplots represent the interquartile range with indicated mean for each condition, whiskers represent maximum and minimum detectable values, and points show values from individual mice.
-
Figure 3—source data 1
Bacterial population quantification data.
- https://cdn.elifesciences.org/articles/110200/elife-110200-fig3-data1-v1.xlsx
-
Figure 3—source data 2
PCA plot data.
- https://cdn.elifesciences.org/articles/110200/elife-110200-fig3-data2-v1.xlsx
Figure 3—figure supplement 1
Addition of B. acidexo to the WildR does not alter community composition and enables in situ measurement of T6SS-mediated fitness.
Recovery of B. acidexo from feces (A) and cecal contents (B) following gavage of germ-free mice with the WildR community and the indicated amount of B. acidexo relative to the endogenous population. (C, D) Recovery of B. acidexo or B. acidexo ΔtssC from feces (D) or cecal contents (E) from mice colonized with the WildR and B. acidexo strains. *p ≤ 0.05 (two-way ANOVA with repeated measures test and Šidák’s multiple comparisons test in C, unpaired t-test in D). For data in panels A–D, boxplots represent the interquartile range with indicated mean for each condition, whiskers represent minimum and maximum values, and points show values from individual mice. (E) Principal coordinate analysis of weighted Unifrac diversity metrics calculated from 16S rRNA amplicon sequencing data from feces collected from mice colonized with the WildR alone or in combination with the indicated strain of B. acidexo. Gavage samples highlighted in pink and remaining timed fecal and cecal (collected at 56 days post-gavage) samples are colored as indicated. Data shown are from one biological replicate, representative of two experiments conducted.
Figure 4 with 1 supplement
P. vulgatus gains a limited fitness benefit from the T6SS-encoding ICE in WildR-colonized mice.
(A) Frequency of mapped ICE junctions deriving from the indicated species as determined by 5′ or 3′ ICE-Seq analysis of DNA extracted from fecal samples collected either 7 or 14 days post-gavage of the WildR into germ-free mice (n = 4). Mice housed in separate or shared cages are indicated. (B) Relative competitive index from in vitro growth competition assays employing P. vulgatus ICE or ICE ΔtssC and recipient strains isolated from the WildR microbiome (Pseudomonadata, gray; Bacteroidota, green). The mean ± SD from three biological replicates is shown. Asterisks indicate recipient species for which the difference in competitive index was statistically significant between donor strains (p < 0.05, unpaired two-tailed t-test). (C) Recovery of P. vulgatus strains containing the indicated versions of the ICE after in vitro growth with B. acidifaciens. The mean ± SD from one biological replicate and its associated technical replicates are shown, which represent results from at least three biological replicates. *p ≤ 0.05 (two-tailed t-test). bae, e; bai, i. (D) Relative abundance of wild-type P. vulgatus in feces collected from mice (n = 4) co-colonized with P. vulgatus ICE or P. vulgatus ICE ΔtssC, as determined by qPCR assays with primers specific for P. vulgatus exo or the parent endogenous strain. Boxplots represent the interquartile range with indicated mean for each condition, whiskers represent minimum and maximum values, points show values from individual mice. *p ≤ 0.05 (two-way ANOVA with repeated measures test and Šidák’s multiple comparisons test). (E) Schematic of experimental design to test the fitness of P. vulexo + T6SS-ICE in the WildR community. (F) Recovery of P. vulexo + ICE (dark blue) or P. vulexo + ICE ΔtssC (light blue) from post-gavage fecal samples of mice co-colonized with the WildR community as depicted in (E). CFUs were determined by plating on selective media (erm). Boxplots represent the interquartile range with indicated mean for each condition, whiskers represent minimum and maximum values, points show values from individual mice. Data in panel F is from two biological replicates with 4 mice per group per replicate (n = 8). *p < 0.05 (two-way ANOVA with repeated measures and Šidák’s multiple comparisons test to compare P. vulgatus ICE and ICE ΔtssC populations), †p < 0.05 (unpaired t-test to compare day 7 and day 56 samples).
-
Figure 4—source data 1
ICE-seq read mapping quantification.
- https://cdn.elifesciences.org/articles/110200/elife-110200-fig4-data1-v1.xlsx
-
Figure 4—source data 2
Bacterial population quantification data.
- https://cdn.elifesciences.org/articles/110200/elife-110200-fig4-data2-v1.xlsx
-
Figure 4—source data 3
PCA plot data.
- https://cdn.elifesciences.org/articles/110200/elife-110200-fig4-data3-v1.xlsx
Figure 4—figure supplement 1
Distribution of the T6SS-ICE in the WildR suggests limited fitness benefit to some Bacteroides sp.
(A) Schematic of ICE-seq approach to identify WildR species encoding the ICE. The junction amplification and sequencing strategy applied to both ends of the ICE is depicted only for the 3′ end for simplicity. (B) Schematic depicting ICE transfer from B. acidifaciens (marked with CmR) to P. vulgatus (marked with ErmR) via in vitro conjugation and selective plating. (C) To-scale schematic of ICE insertion sites in P. vulgatusexo + ICE transconjugants that acquired the indicated versions of the ICE. (D) Abundance (relative to total P. vulgatus) of the indicated P. vulgatusexo in fecal samples from mice co-colonized with the WildR community, as determined by qPCR. Boxplots represent the interquartile range with indicated mean for each condition, whiskers represent minimum and maximum values, and points show values from individual mice (n = 8) from two biological replicates. Asterisks indicate significant differences between P. vulexo + ICE and P. vulexo + ICE ΔtssC frequency at the indicated time points (p < 0.05, Šídák’s multiple comparisons test, mixed model ANOVA with multiple comparisons). N.D., not detected. (E) Principal coordinate analysis of weighted Unifrac diversity metrics calculated from 16S rRNA gene amplicon sequencing data from feces collected from mice (n=8/group across 2 biological replicates) colonized with the WildR and either P. vulexo + ICE (closed circles) or P. vulexo + ICE ΔtssC (open circles). The community composition varied between groups at early time points (purple; Rep 1, p = 0.021, pseudo-F = 2.7; Rep 2, p = 0.011, pseudo-F = 12, PERMANOVA test), but varied less or not significantly at late time points (orange; Rep 1, p = 0.25, pseudo-F = 1.3; Rep 2, p = 0.003, pseudo-F = 5).
Author response image 1
The T6SS of B. acidifaciens targets a WildR-derived P. vulgatus strain.
CFUs indicate populations of the indicated strains after co-culture of wild-type or T6SS-inactivated B. acidifaciens with P. vulgatus. Data represent means and standard errors (n=3, *P<0.01, t-test with log ><0.01, t- test with log transformed data)
Author response image 2
ICE-seq analysis indicates that introduction of P. vulgatus ICE into WildR-colonized mice has little impact on ICE distribution among endogenous strains.
Graphs show frequency of mapped ICE junctions deriving from the indicated species as determined by 5¢ or 3¢ ICE-Seq analysis of DNA extracted from fecal samples collected either 7 or 56 days post-gavage of the WildR and P. vulgatus ICE into germ-free mice.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Bacteroides acidifaciens) | WR-F2 | WildR isolate (this study) | Genome accession: JBUERP000000000 | |
| Strain, strain background (B. caecimuris) | WR-F5; F5 | WildR isolate (this study) | Genome accession: JBUERM000000000 | |
| Strain, strain background (B. caecimuris) | WR-F12; F12 | WildR isolate (this study) | Genome accession: JBUERL000000000 | |
| Strain, strain background (B. uniformis) | WR-A2 | WildR isolate (this study) | Genome accession: JBUERN000000000 | |
| Strain, strain background (B. thetaiotaomicron) | WR-F3 | WildR isolate (this study) | Genome accession: JBUERK000000000 | |
| Strain, strain background (B. sp910578895) | WildR isolate (this study) | WildR MAG #bin69 | ||
| Strain, strain background (Duncaniella freteri) | WR-YR29 | WildR isolate (this study) | Genome accession: JBUERU000000000 | |
| Strain, strain background (Enterococcus casseliflavus) | WR-B2 | WildR isolate (this study) | Genome accession: JBUERQ000000000 | |
| Strain, strain background (Escherichia fergusonii) | WildR isolate (this study) | |||
| Strain, strain background (Lactobacillus johnsonii) | WR-F4 | WildR isolate (this study) | Genome accession: JBUPWC000000000 | |
| Strain, strain background (Ligilactobacillus murinus) | WR-A5 | WildR isolate (this study) | Genome accession: JBUERI000000000 | |
| Strain, strain background (Limosilactobacillus reuteri) | WR-E9 | WildR isolate (this study) | Genome accession: JBUERJ000000000 | |
| Strain, strain background (Muribaculum caecicola) | WR-YR7 | WildR isolate (this study) | Genome accession: JBUERR000000000 | |
| Strain, strain background (Muribaculum intestinale) | WR-C85 | WildR isolate (this study) | Genome accession: JBUERS000000000 | |
| Strain, strain background (Parabacteroides distasonis) | WR-A11 | WildR isolate (this study) | Genome accession: JBUERO000000000 | |
| Strain, strain background (Phocaeicola vulgatus) | WR-A6; parental | WildR isolate (this study) | Genome accession: JBUPWD000000000 | |
| Strain, strain background (Sporofaciens musculi) | WR-N50 | WildR isolate (this study) | Genome accession: JBUERT000000000 | |
| Strain, strain background (Escherichia coli) | EC100D pir+ (plasmid maintenance) | PMID: 8125283 | Genotype: F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL (StrR) nupG pir+ (DHRF). | |
| Strain, strain background (E. coli) | S17-1 λpir (conjugation) | PMID: 6340113 | Genotype: recA pro hsdR RP4-2-Tc::Mu-Km::Tn7 λ-pir. | |
| Strain, strain background (E. coli) | S17-1 λpir + RK231 (conjugation) | PMID: 1615064 | Genotype: E. coli S17 lambda pir with RK231 plasmid, KanR. | |
| Strain, strain background (B. acidifaciens) | ErmR; B. acidexo (marked strain with erythromycin resistance, ErmR) | This paper | Genotype: att1::pNBU2-ermG. | |
| Strain, strain background (B. acidifaciens) | ∆tssC (inactive T6SS) | This paper | Genotype: ∆ACY5BC_08310. | |
| Strain, strain background (B. acidifaciens) | ∆tssC; B. acidexo ∆tssC (ErmR) | This paper | Genotype: ∆ACY5BC_08310, att1::pNBU2-ermG. | |
| Strain, strain background (B. acidifaciens) | ∆e1 ∆i1 (ErmR) | This paper | Genotype: ∆ACY5BC_08390, ∆ACY5BC_08395, att::pNBU2-ermG. | |
| Strain, strain background (B. acidifaciens) | ∆e2 ∆i2 (ErmR) | This paper | Genotype: ∆ACY5BC_08435, ∆ACY5BC_08440, att::pNBU2-ermG. | |
| Strain, strain background (B. acidifaciens) | ∆e1 ∆i1 ∆e2 ∆i2 (ErmR) | This paper | Genotype: ∆ACY5BC_08390, ∆ACY5BC_08395, ∆ACY5BC_08435, ∆ACY5BC_08440, att::pNBU2-ermG. | |
| Strain, strain background (B. acidifaciens) | ∆tssN (inactive T6SS) | This paper | Genotype: ∆ACY5BC_08340. | |
| Strain, strain background (B. acidifaciens) | ∆clpV (inactive T6SS) | This paper | Genotype: ∆ACY5BC_08330. | |
| Strain, strain background (B. acidifaciens) | ∆clpV + pNBU2-ermG::empty | This paper | Genotype: ∆ACY5BC_08330, att::pNBU2-ermG. | |
| Strain, strain background (B. acidifaciens) | ∆clpV + pNBU2-ermG::P5E4-clpV | This paper | Genotype: ∆ACY5BC_08330, att::pNBU2-ermG-P5E4-clpV. | |
| Strain, strain background (B. acidifaciens) | CmR (CAT gene located on ICE) | This paper | Genotype: P1-GH023-CAT-term_intergenic(BA_01751/BA_01752). | |
| Strain, strain background (B. acidifaciens) | ∆tssC CmR (CAT gene located on ICE) | This paper | Genotype: ∆ACY5BC_08310, P1-GH023-CAT-term_intergenic(BA_01751/BA_01752). | |
| Strain, strain background (B. acidifaciens) | ∆e1 ∆i1 ∆e2 ∆i2 CmR (CAT gene located on ICE) | This paper | Genotype: ∆ACY5BC_08390, ∆ACY5BC_08395, ∆ACY5BC_08435, ∆ACY5BC_08440, P1-GH023-CAT-term_intergenic(BA_01751/BA_01752). | |
| Strain, strain background (B. caecimuris) | F5 ErmR | This paper | Genotype: att::pNBU2-ermG. | |
| Strain, strain background (B. uniformis) | ErmR | This paper | Genotype: att::pNBU2-ermG. | |
| Strain, strain background (B. thetaiotaomicron) | ErmR | This paper | Genotype: att::pNBU2-ermG. | |
| Strain, strain background (B. caecimuris) | F12 ErmR | This paper | Genotype: att::pNBU2-ermG. | |
| Strain, strain background (P. distasonis) | ErmR | This paper | Genotype: att::pNBU2-ermG. | |
| Strain, strain background (P. vulgatus) | ErmR | This paper | Genotype: att2::pNBU2-ermG. | |
| Strain, strain background (P. vulgatus) | ICE; P. vulgatus exo + ICE | This paper | Genotype: ICE -intergenic(ACZBVK_01235/ACZBVK_01240), ICE genotype[CmR], att2::pNBU2-ermG. | |
| Strain, strain background (P. vulgatus) | ICE ΔtssC; P. vulgatus exo + ICE ΔtssC | This paper | Genotype: ACZBVK_12250::ICE, ICE genotype[∆ACY5BC_08310, CmR], att2::pNBU2-ermG. | |
| Strain, strain background (P. vulgatus) | ErmR + ICE ∆baei1 ∆baei2 CmR; ∆e1 ∆i1 ∆e2 ∆i2 | This paper | Genotype: ICE-intergenic(ACZBVK_12055/ACZBVK_12060), ICE genotype[∆ACY5BC_08390, ∆ACY5BC_08395, ∆ACY5BC_08435, ∆ACY5BC_08440,CmR], att2::pNBU2-ermG. | |
| Strain, strain background (Mus musculus, M/F) | Swiss Webster | Taconic Biosciences | Tac:SW | Germ-free. |
| Strain, strain background (M. musculus, M/F) | C57BL/6 | Germ-free. | ||
| Biological sample (M. musculus) | WildR reference microbiome (F6 generation ileo-cecal contents) | Taconic Biosciences; https://www.taconic.com/services/microbiome/wild-mouse-microbiome | ||
| Recombinant DNA reagent | pSIE1 | PMID: 31712278 | Suicide vector, allelic exchange in Bacteroides, ErmR, AmpR. | |
| Recombinant DNA reagent | pSIE1::∆Ba-tssC | This paper | Deletion construct carrying 1 kb flanking regions of ACY5BC_08310 (tssC), ErmR, AmpR. | |
| Recombinant DNA reagent | pLGB13 | PMID: 31409684 | Suicide vector, allelic exchange in Bacteroides, ErmR, AmpR. | |
| Recombinant DNA reagent | pLGB13-RMsilent | This paper | Suicide vector with 8 point mutations to remove B. acidifaciens specific methylated motifs and facilitate plasmid transfer. | |
| Recombinant DNA reagent | pLGB13-RMsilent::∆Ba-bae1-bai1 | This paper | Deletion construct carrying ~1 kb flanking regions of ACY5BC_08390 and ACY5BC_08395 (effector-immunity pair #1), ErmR, AmpR. | |
| Recombinant DNA reagent | pLGB13-RMsilent::∆Ba-bae2-bai2 | This paper | Deletion construct carrying ~1 kb flanking regions of ACY5BC_08435 and ACY5BC_08440 (effector-immunity pair #2), ErmR, AmpR. | |
| Recombinant DNA reagent | pLGB13-RMsilent::∆Ba-tssN | This paper | Deletion construct carrying ~1 kb flanking regions of ACY5BC_08340 (tssN), ErmR, AmpR. | |
| Recombinant DNA reagent | pLGB13-RMsilent::∆Ba-clpV | This paper | Deletion construct carrying ~1 kb flanking regions of ACY5BC_08330 (clpV), ErmR, AmpR. | |
| Recombinant DNA reagent | pLGB13-RMsilent::Ba-ICE-P1-GH023-CAT-term | This paper | Insertion construct carrying ~1 kb flanking regions to integrate P1 promoter, GH023 RBS, CAT gene, and terminator between BA_01751 and BA_01752 (on the ICE), ErmR, AmpR, CmR. | |
| Recombinant DNA reagent | pNBU2-ermG | PMID: 18611383 | Integrates into single NBU2 attB site in Bacteroides genomes, ErmR, AmpR. | |
| Recombinant DNA reagent | pNBU2-ermG-us1311 | PMID: 26918244 | Derivative of pNBU2-ermG containing constitutive promoter (us1311) to drive expression of inserted gene, ErmR, AmpR. | |
| Recombinant DNA reagent | pNBU2-ermG-us1311::tssC | This paper | PNBU2 integrative vector containing constitutive promoter (us1311) to drive expression of tssC (ACY5BC_08310) from B. acid, ErmR, AmpR. | |
| Recombinant DNA reagent | pNBU2-ermG-us1311::tssC_singleRMsilent | This paper | Derivative of pNBU2-ermG-us1311::tssC with a two bp mutation in the plasmid to remove a single methylated site (GATATC). Other methylated motifs still exist in the plasmid. ErmR, AmpR. | |
| Recombinant DNA reagent | pNBU2-ermG::P5E4 | PMID: 28431251 | Integrates into single NBU2 attB site in Bacteroides genomes, contains constitutive promoter and RBS site (P5E4), ErmR, AmpR. | |
| Recombinant DNA reagent | pNBU2-ermG-RMsilent::P5E4 | This paper | Integrative vector with 4 point mutations to remove B. acidifaciens specific methylated motifs and facilitate plasmid transfer, ErmR, AmpR. | |
| Recombinant DNA reagent | pNBU2-ermG-RMsilent::P5E4-clpV | This paper | Integration plasmid construct to express clpV from P5E4 promoter sequence, ErmR, AmpR. | |
| Sequence-based reagent | gyrB-UP-1 | PMID: 21948050 | Species/strain identification primer for initial identification of Bacteroides sp isolated from the WildR. GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYGA | |
| Sequence-based reagent | gyrB_UP-2r | PMID: 21948050 | Species/strain identification primer for initial identification of Bacteroides sp isolated from the WildR. AGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRTCNGTCAT | |
| Sequence-based reagent | gyrB-UP-1S | PMID: 21948050 | Species/strain identification primer for initial identification of Bacteroides sp isolated from the WildR. GAAGTCATCATGACCGTTCTGCA | |
| Sequence-based reagent | 8F | PMID: 16672469 | Species/strain identification primer for strain identification by amplifying entire 16S rRNA gene and sequencing. AGAGTTTGATCCTGGCTCAG | |
| Sequence-based reagent | 1391R | PMID: 17416689 | Species/strain identification primer for strain identification by amplifying entire 16S rRNA gene and sequencing. GACGGGCGGTGWGTRCA | |
| Sequence-based reagent | 16 S_v3v4_fwd_Illumina | PMID: 22933715 | Sequencing primer for sequencing V3V4 region of 16S rRNA for bacterial identification in the WildR community. TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG | |
| Sequence-based reagent | 16S_v3v4_rev_Illumina | PMID: 22933715 | Sequencing primer for sequencing V3V4 region of 16S rRNA for bacterial identification in the WildR community. GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC | |
| Sequence-based reagent | ICE-3p_1a | This paper | Sequencing primer for generating sequencing libraries of ICE-genome junctions from the 3' end of the GA1 T6SS ICE. GGAAATGCACTCCCCAAGACAAGTAAATGA | |
| Sequence-based reagent | ICE-3p_2 | This paper | Sequencing primer for generating sequencing libraries of ICE-genome junctions from the 3' end of the GA1 T6SS ICE. AATGATACGGCGACCACCGAGATCTACACCATTTTATAATATACTGATTATAAGTGCATTGCGGTGATATTTTTATGACAGTTTTG | |
| Sequence-based reagent | ICE-3p_seq | This paper | Sequencing primer for sequencing ICE-genome junctions from the 3' end of the GA1 T6SS ICE. AAGTGCATTGCGGTGATATTTTTATGACAGTTTTG | |
| Sequence-based reagent | ICE-5p_1b | This paper | Sequencing primer for generating sequencing libraries of ICE-genome junctions from the 5' end of the GA1 T6SS ICE. CTGAAAACAACGGAAAGAAACAACAACCAC | |
| Sequence-based reagent | ICE-5p_2* | This paper | Sequencing primer for generating sequencing libraries of ICE-genome junctions from the 5' end of the GA1 T6SS ICE. AATGATACGGCGACCACCGAGATCTACACGTTTGTTTATATTTTCCTGTATCTTGTTTTCATTTTACACACATCTATAAG | |
| Sequence-based reagent | ICE-5p_SEQ | This paper | Sequencing primer for sequencing ICE-genome junctions from the 5' end of the GA1 T6SS ICE. TCCTGTATCTTGTTTTCATTTTACACACATCTATAAG | |
| Sequence-based reagent | olj376_1 | PMID: 30798550 | Sequencing primer for generating sequencing libraries of ICE-genome junctions. Primer amplifies from the polyC-tail added to sheared gDNA in conjunction with either ICE-3p_1a or ICE-5p_1b. GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGGGGGGGGGGGGGGG | |
| Sequence-based reagent | TdT_i8_U7001 | PMID: 30798550 | Indexing primer #1 for generating sequencing libraries of ICE-genome junctions. Index sequence modified to contain 10 bases compared to primers described in original publication. Use with ICE-3p_2. CAAGCAGAAGACGGCATACGAGATCGCTCAGTTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT | |
| Sequence-based reagent | TdT_i8_U7002 | PMID: 30798550 | Indexing primer #1 for generating sequencing libraries of ICE-genome junctions. Index sequence modified to contain 10 bases compared to primers described in original publication. Use with ICE-3p_2. CAAGCAGAAGACGGCATACGAGATTATCTGACCTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT | |
| Sequence-based reagent | TdT_i8_U7003 | PMID: 30798550 | Indexing primer #1 for generating sequencing libraries of ICE-genome junctions. Index sequence modified to contain 10 bases compared to primers described in original publication. Use with ICE-3p_2. CAAGCAGAAGACGGCATACGAGATATATGAGACGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT | |
| Sequence-based reagent | TdT_i8_U7004 | PMID: 30798550 | Indexing primer #1 for generating sequencing libraries of ICE-genome junctions. Index sequence modified to contain 10 bases compared to primers described in original publication. Use with ICE-3p_2. CAAGCAGAAGACGGCATACGAGATCTTATGGAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT | |
| Sequence-based reagent | TdT_i8_U7011 | PMID: 30798550 | Indexing primer #5 for generating sequencing libraries of ICE-genome junctions. Index sequence modified to contain 10 bases compared to primers described in original publication. Use with ICE-5p_2. CAAGCAGAAGACGGCATACGAGATGAACATACGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT | |
| Sequence-based reagent | TdT_i8_U7012 | PMID: 30798550 | Indexing primer #5 for generating sequencing libraries of ICE-genome junctions. Index sequence modified to contain 10 bases compared to primers described in original publication. Use with ICE-5p_2. CAAGCAGAAGACGGCATACGAGATCCTATGACTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT | |
| Sequence-based reagent | TdT_i8_U7013 | PMID: 30798550 | Indexing primer #5 for generating sequencing libraries of ICE-genome junctions. Index sequence modified to contain 10 bases compared to primers described in original publication. Use with ICE-5p_2. CAAGCAGAAGACGGCATACGAGATTAATGGCAAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT | |
| Sequence-based reagent | TdT_i8_U7014 | PMID: 30798550 | Indexing primer #5 for generating sequencing libraries of ICE-genome junctions. Index sequence modified to contain 10 bases compared to primers described in original publication. Use with ICE-5p_2. CAAGCAGAAGACGGCATACGAGATGTGCCGCTTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT | |
| Sequence-based reagent | Read1_Seq | PMID: 30798550 | Sequencing primer: Sequencing primer to amplify PhiX reads from ICE-seq sample run. ACACTCTTTCCCTACACGACGCTCTTCCGATCT | |
| Sequence-based reagent | PVirpA-qPCR-F | This paper | qPCR primer to quantify P. vulgatus wildR isolate by qPCR. CATGGTGGGAAAAGAGTGAAGC | |
| Sequence-based reagent | PVirpA-qPCR-R | This paper | qPCR primer to quantify P. vulgatus wildR isolate by qPCR. CTGTAATCCGTCCAAGTCCAAAG | |
| Sequence-based reagent | BCF5DessicResist-qPCR-F | This paper | qPCR primer to quantify B. caecimuris F5 wildR isolate by qPCR. CTAACGGAGGTATATCAGTAGGCC | |
| Sequence-based reagent | BCF5DessicResist-qPCR-R | This paper | qPCR primer to quantify B. caecimuris F5 wildR isolate by qPCR. TTTCCCTTGCCCAGATTAGGAG | |
| Sequence-based reagent | BApehX-qPCR-F | This paper | qPCR primer to quantify B. acidifaciens wildR isolate by qPCR in in vitro competitions. CTTCGTGACCCTGTATTTTGGAAC | |
| Sequence-based reagent | BApehX-qPCR-R | This paper | qPCR primer to quantify B. acidifaciens wildR isolate by qPCR in in vitro competitions. AATTCCGTCCGTATTAGTCCAGTC | |
| Sequence-based reagent | BUamyX-qPCR-F | This paper | . | qPCR primer to quantify B. uniformis wildR isolate by qPCR. ATCTACGTGACTTTACCGCCTC |
| Sequence-based reagent | BUamyX-qPCR-R | This paper | qPCR primer to quantify B. uniformis wildR isolate by qPCR. TATACCCCCAACTGTCGTTTCC | |
| Sequence-based reagent | BTphoA-qPCR-F | This paper | qPCR primer to quantify B. thetaiotaomicron wildR isolate by qPCR. TATGGAGTAGACTTGGTGCTTCAG | |
| Sequence-based reagent | BTphoA-qPCR-R | This paper | qPCR primer to quantify B. thetaiotaomicron wildR isolate by qPCR. GAAAGACAAACGGTAACTCTTCGG | |
| Sequence-based reagent | PBDnanM-qPCR-F | This paper | qPCR primer to quantify P. distasonis wildR isolate by qPCR. CACGTCCGATAATTCTTGGAGC | |
| Sequence-based reagent | PBDnanM-qPCR-R | This paper | qPCR primer to quantify P. distasonis wildR isolate by qPCR. GTTACCTCTACGTCCACCTATGAG | |
| Sequence-based reagent | Pv_att2_qPCR_F | This paper | qPCR primer to quantify unmarked P. vulgatus when present with erm-marked P. vulgatus strain by qPCR. TTTGCAATTCTTTCCAGCGG | |
| Sequence-based reagent | Pv_att2_qPCR_R | This paper | qPCR primer to quantify unmarked P. vulgatus when present with erm-marked P. vulgatus strain by qPCR. GTGGCAGAGTGGTCGATTGC | |
| Sequence-based reagent | ermG-qPCR-F | This paper | qPCR primer to detect strain marked with pNBU2-erm by qPCR. AACATCTTTGAAATAGGTGCAGGG | |
| Sequence-based reagent | ermG-qPCR-R | This paper | qPCR primer to detect strain marked with pNBU2-erm by qPCR. TCTATCGCCGTTACAAAATTACATC | |
| Sequence-based reagent | rpsR-bacteroides-qPCR-F | This paper | qPCR primer to quantify total Bacteroides, Parabacteroides, and Phocaeicola sp in WildR samples by qPCR. CAATCAGAAATCAGATATTTAACTCCG | |
| Sequence-based reagent | rpsR-bacteroides-qPCR-R | This paper | qPCR primer to quantify total Bacteroides, Parabacteroides, and Phocaeicola sp in WildR samples by qPCR. CAAGAATTTCTTCAAGAATTCAGGATC | |
| Sequence-based reagent | BA-qPCR-F | This paper | qPCR primer to quantify B. acidifaciens by qPCR in wildR samples. CTGGAGGCAAAAACGTATTCAGAG | |
| Sequence-based reagent | BA-qPCR-R | This paper | qPCR primer to quantify B. acidifaciens by qPCR in wildR samples. CTTTTGACCGTCCAATCGTATAGC | |
| Sequence-based reagent | Mi-qPCR-F | This paper | qPCR primer to quantify Muribaculum intestinale by qPCR in in vitro competitions. AGGCTTGTAGACCTTGATGAGATG | |
| Sequence-based reagent | Mi-qPCR-R | This paper | qPCR primer to quantify Muribaculum intestinale by qPCR in in vitro competitions. CACTGTGCATATATGTTGAGCCTG | |
| Sequence-based reagent | Sm-qPCR-F | This paper | qPCR primer to quantify Sporofaciens musculi by qPCR in in vitro competitions. TGTTGTTCAGCAGGTAGATACTCC | |
| Sequence-based reagent | Sm-qPCR-R | This paper | qPCR primer to quantify Sporofaciens musculi by qPCR in in vitro competitions. CTACAAAGTTCATCTGCGGTGATC | |
| Sequence-based reagent | Mg-qPCR-F | This paper | qPCR primer to quantify Muribaculum caecicola by qPCR in in vitro competitions. TACTGTGTGCATGGATCTATACGG | |
| Sequence-based reagent | Mg-qPCR-R | This paper | qPCR primer to quantify Muribaculum caecicola by qPCR in in vitro competitions. ACACAACGTCTTTATGCCTTGATG | |
| Sequence-based reagent | Df-qPCR-F | This paper | qPCR primer to quantify Duncaiella freteri by qPCR in in vitro competitions. ATAATGGTCAGGCTCGGTAGAATC | |
| Sequence-based reagent | Df-qPCR-R | This paper | qPCR primer to quantify Duncaiella freteri by qPCR in in vitro competitions. GAGGAGGCAAGGGATATCTATTGG | |
| Sequence-based reagent | Bsp95-qPCR-F | This paper | qPCR primer to quantify Bacteroides sp. 910578895 by qPCR in in vitro competitions. ACTATCCTAACGGTGTATTGGCAG | |
| Sequence-based reagent | Bsp95-qPCR-R | This paper | qPCR primer to quantify Bacteroides sp. 910578895 by qPCR in in vitro competitions. AGAGTAGTTCACACCCAAAGTAGC | |
| Sequence-based reagent | pSIE1-Ba-tssC-frag1-F | This paper | Cloning primer (allelic exchange) to amplify ~1 kb flanking regions around tssC (ACY5BC_08310) from B. acidifaciens genome to insert into pSIE1 digested with SpeI and NotI. Corresponding plasmid: pSIE1::∆Ba-tssC. ATTAGCATTATGAGGATCCACCACGGTTATCTGTGCCTTTC | |
| Sequence-based reagent | pSIE1-Ba-tssC-frag1-R | This paper | Cloning primer (allelic exchange) to amplify ~1 kb flanking regions around tssC (ACY5BC_08310) from B. acidifaciens genome to insert into pSIE1 digested with SpeI and NotI. Corresponding plasmid: pSIE1::∆Ba-tssC. CAGAAGATTACATCTTGCTAAAAGATTAAAGTTCTACC | |
| Sequence-based reagent | pSIE1-Ba-tssC-frag2-F | This paper | Cloning primer (allelic exchange) to amplify ~1 kb flanking regions around tssC (ACY5BC_08310) from B. acidifaciens genome to insert into pSIE1 digested with SpeI and NotI. Corresponding plasmid: pSIE1::∆Ba-tssC. TAGCAAGATGTAATCTTCTGAACAGTTTTAAATTTACAG | |
| Sequence-based reagent | pSIE1-Ba-tssC-frag1-R | This paper | Cloning primer (allelic exchange) to amplify ~1 kb flanking regions around tssC (ACY5BC_08310) from B. acidifaciens genome to insert into pSIE1 digested with SpeI and NotI. Corresponding plasmid: pSIE1::∆Ba-tssC. TTCCCCTCCACCGCGGTGGCTCAACTCTTGTTGCGTCTG | |
| Sequence-based reagent | pLGB13-RM silent-Frag1-F | This paper | Cloning primer (allelic exchange) to amplify part of pLGB13 backbone (no mutations) for assembly into pLGB13-Rmsilent. Corresponding plasmid: pLGB13-RMsilent. GTTTACTCATAACGCGTCAATTC | |
| Sequence-based reagent | pLGB13-RM silent-Frag1-R | This paper | Cloning primer (allelic exchange) to amplify part of pLGB13 backbone (no mutations) for assembly into pLGB13-Rmsilent. Corresponding plasmid: pLGB13-RMsilent. AATTCCCATGTCAGCCGTTAAG | |
| Sequence-based reagent | pLGB13-RM silent-Frag2-F | This paper | Cloning primer (allelic exchange) to amplify part of pLGB13 backbone (no mutations) for assembly into pLGB13-Rmsilent. Corresponding plasmid: pLGB13-RMsilent. AGCAGCTCTAATGCGCTGTTAATCAC | |
| Sequence-based reagent | pLGB13-RM silent-Frag2-R | This paper | Cloning primer (allelic exchange) to amplify part of pLGB13 backbone (no mutations) for assembly into pLGB13-Rmsilent. Corresponding plasmid: pLGB13-RMsilent. CGTACCGCTGACACCAAGTCCG | |
| Sequence-based reagent | pLGB13-RM silent-Frag3-F | This paper | Cloning primer (allelic exchange) to amplify part of pLGB13 backbone (no mutations) for assembly into pLGB13-Rmsilent. Corresponding plasmid: pLGB13-RMsilent. CCTTACTTGTGCCTGTTCTATTTC | |
| Sequence-based reagent | pLGB13-RM silent-Frag3-R | This paper | Cloning primer (allelic exchange) to amplify part of pLGB13 backbone (no mutations) for assembly into pLGB13-Rmsilent. Corresponding plasmid: pLGB13-RMsilent. GTCGCTATATAATTTGGTGAATTG | |
| Sequence-based reagent | pLBG13-RMsilent-baei1-Frag1-F | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08390 and ACY5BC_08395 (baei1) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-bae1-bai1. CGGTGTAAGATTAGCATTATGAGTGGATCCGGGATTGGGAGGATTTCTC | |
| Sequence-based reagent | pLBG13-RMsilent-baei1-Frag1-R | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08390 and ACY5BC_08395 (baei1) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-bae1-bai1. ACTTATAATCAACGTCCGCGAGTAACATGGC | |
| Sequence-based reagent | pLBG13-RMsilent-baei1-Frag2a-F | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08390 and ACY5BC_08395 (baei1) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-bae1-bai1. TTACTCGCGGACGTTGATTATAAGTAAAAATTGCTATTG | |
| Sequence-based reagent | pLBG13-RMsilent-baei1-Frag2a-R | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08390 and ACY5BC_08395 (baei1) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-bae1-bai1. TAACATATCTGGAGTAAATAACCGAATGCTC | |
| Sequence-based reagent | pLBG13-RMsilent-baei1-Frag2b-F | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08390 and ACY5BC_08395 (baei1) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-bae1-bai1. TCGGTTATTTACTCCAGATATGTTAAGGGAATTGAAC | |
| Sequence-based reagent | pLBG13-RMsilent-baei1-Frag2b-R | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08390 and ACY5BC_08395 (baei1) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-bae1-bai1. CCATCACTGGAAGATAGGCAATTAGTCGACGTTGGCGTATGATATAGTATATG | |
| Sequence-based reagent | pLBG13-RMsilent-baei2-Frag2-F | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08435 and ACY5BC_08440 (baei2) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-bae2-bai2. ACATATTCAGGAATCTTGAGGTCATTGATGAATCTTTTGG | |
| Sequence-based reagent | pLBG13-RMsilent-baei2-Frag2-R | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08435 and ACY5BC_08440 (baei2) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-bae2-bai2. ACTGGAAGATAGGCAATTAGTCGACTTGATTATTAAACGAATAGTATTCTC | |
| Sequence-based reagent | pLGB13-RMsilent-Ba-tssN-Frag1-F | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08340 (tssN) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-tssN. TAAGATTAGCATTATGAGTGGATCCAAACAATCAAGCCGGGTG | |
| Sequence-based reagent | pLGB13-RMsilent-Ba-tssN-Frag1-R | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08340 (tssN) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-tssN. TTTTTCTCTATTTGTACGCGC | |
| Sequence-based reagent | pLGB13-RMsilent-Ba-tssN-Frag2-F | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08340 (tssN) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-tssN. CGCGTACAAATAGAGAAAAAATC | |
| Sequence-based reagent | pLGB13-RMsilent-Ba-tssN-Frag2-R | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08340 (tssN) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-tssN. ACTGGAAGATAGGCAATTAGTCGACTCGTATATTAGCCCGGTC | |
| Sequence-based reagent | pLGB13-RMsilent-Ba-clpV-Frag1-F | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08330 (clpV) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-clpV. TAAGATTAGCATTATGAGTGGATCCCGAAGGAGAGCATCGAGAG | |
| Sequence-based reagent | pLGB13-RMsilent-Ba-clpV-Frag1-R | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08330 (clpV) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-clpV. TTTCGATAGTTTATGATGATACTGTCG | |
| Sequence-based reagent | pLGB13-RMsilent-Ba-clpV-Frag2-F | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08330 (clpV) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-clpV. ATCATCATAAACTATCGAAACG | |
| Sequence-based reagent | pLGB13-RMsilent-Ba-clpV-Frag2-R | This paper | Cloning primer (allelic exchange) for deletion of ACY5BC_08330 (clpV) by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::∆Ba-clpV. ACTGGAAGATAGGCAATTAGTCGACAAGTCCGTTTCTCCGTAC | |
| Sequence-based reagent | pLGB13-RMsilent-ICE-CmR-Frag1-F | This paper | Cloning primer (allelic exchange) for insertion of P1-GH023-CAT-term on ICE by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::Ba-ICE-P1-GH023-CAT-term. CGGTGTAAGATTAGCATTATGAGTGGATCCTACGCTCTATGATGTGTC | |
| Sequence-based reagent | pLGB13-RMsilent-ICE-CmR-Frag1-R | This paper | Cloning primer (allelic exchange) for insertion of P1-GH023-CAT-term on ICE by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::Ba-ICE-P1-GH023-CAT-term. GGCTTTCTTCTCTTGGAAAG | |
| Sequence-based reagent | pLGB13-RMsilent-ICE-CmR-Frag3-F | This paper | Cloning primer (allelic exchange) for insertion of P1-GH023-CAT-term on ICE by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::Ba-ICE-P1-GH023-CAT-term. GAGAAGGCCATCCTGACG | |
| Sequence-based reagent | pLGB13-RMsilent-ICE-CmR-Frag3-R | This paper | Cloning primer (allelic exchange) for insertion of P1-GH023-CAT-term on ICE by Gibson Assembly into BamHI and SalI linearized pLGB13-RMsilent. Corresponding plasmid: pLGB13-RMsilent::Ba-ICE-P1-GH023-CAT-term. CCATCACTGGAAGATAGGCAATTAGTCGACATTATCGGTTTATCCTGTACGC | |
| Sequence-based reagent | pNBU2-erm-us1311-tssC-F | This paper | Cloning primer (allelic exchange) to amplify B. acidifaciens tssC gene to insert into pNBU2-ermG-us1311 digested with NdeI and XbaI. Corresponding plasmid: pNBU2-ermG-us1311::tssC. CTCCAAATCTGTTTTTAACATATGAAGCAGGAAACGCAACAAC | |
| Sequence-based reagent | pNBU2-erm-us1311-tssC-R | This paper | Cloning primer (allelic exchange) to amplify B. acidifaciens tssC gene to insert into pNBU2-ermG-us1311 digested with NdeI and XbaI. Corresponding plasmid: pNBU2-ermG-us1311::tssC. GCCCGGGGGATCCACTAGTTCTAGATTATTCCTGGTGATATTCGCTTTC | |
| Sequence-based reagent | pNBU2-tssC-singleRMsilent-QCprimer | This paper | Cloning primer (allelic exchange): Primer for quick change to remove a single methylated motif from pNBU2-ermG-us1311::tssC plasmid. Bold residues indicate two modified bases in the final plasmid on the template strand. Corresponding plasmid: pNBU2-ermG-us1311::tssC_singleRMsilent. GGATCCCCCGGGCTGTGGGAATTCGATATCAAGCTTATCGATACC | |
| Sequence-based reagent | pNBU2-ermG-P5E4-RMsilent-Frag1-F | This paper | Cloning primer (allelic exchange) to amplify part of pNBU2-ermG::P5E4 backbone to assemble plasmid without B. acidifaciens methylated motifs. Corresponding plasmid: pNBU2-ermG-RMsilent::P5E4. AGCTTGTTGGTACATCCG | |
| Sequence-based reagent | pNBU2-ermG-P5E4-RMsilent-Frag1-R | This paper | Cloning primer (allelic exchange) to amplify part of pNBU2-ermG::P5E4 backbone to assemble plasmid without B. acidifaciens methylated motifs. Corresponding plasmid: pNBU2-ermG-RMsilent::P5E4. CAGACCGATACGCATATC | |
| Sequence-based reagent | pNBU2-ermG-P5E4-RMsilent-Frag2-F | This paper | Cloning primer (allelic exchange) to amplify part of pNBU2-ermG::P5E4 backbone to assemble plasmid without B. acidifaciens methylated motifs. Corresponding plasmid: pNBU2-ermG-RMsilent::P5E4. GAACGTACTCATGGTTCATC | |
| Sequence-based reagent | pNBU2-ermG-P5E4-RMsilent-Frag2-R | This paper | Cloning primer (allelic exchange) to amplify part of pNBU2-ermG::P5E4 backbone to assemble plasmid without B. acidifaciens methylated motifs. Corresponding plasmid: pNBU2-ermG-RMsilent::P5E4. TGACAGTTACCAATGTTTAATCAGTGAGGCACCTATC | |
| Sequence-based reagent | pNBU2-ermG-P5E4-RMsilent-Frag3-F | This paper | Cloning primer (allelic exchange) to amplify part of pNBU2-ermG::P5E4 backbone and introduce a point mutation to assemble plasmid without B. acidifaciens methylated motifs. Corresponding plasmid: pNBU2-ermG-RMsilent::P5E4. GCCTCACTGATTAAACATTGGTAACTGTCAGACCAAGTTTAC | |
| Sequence-based reagent | pNBU2-ermG-P5E4-RMsilent-Frag3-R | This paper | Cloning primer (allelic exchange) to amplify part of pNBU2-ermG::P5E4 backbone and introduce a point mutation to assemble plasmid without B. acidifaciens methylated motifs. Corresponding plasmid: pNBU2-ermG-RMsilent::P5E4. TCACAATATGAGCAACAAG | |
| Sequence-based reagent | pNBU2-ermG-P5E4-RMsilent-Frag4-F | This paper | Cloning primer (allelic exchange) to amplify part of pNBU2-ermG::P5E4 backbone and introduce a point mutation to assemble plasmid without B. acidifaciens methylated motifs. Corresponding plasmid: pNBU2-ermG-RMsilent::P5E4. CTTGATGTCGAATTCCTACAGCCCGGGGGATCCACC | |
| Sequence-based reagent | pNBU2-ermG-P5E4-RMsilent-Frag4-R | This paper | Cloning primer (allelic exchange) to amplify part of pNBU2-ermG::P5E4 backbone and introduce a point mutation to assemble plasmid without B. acidifaciens methylated motifs. Corresponding plasmid: pNBU2-ermG-RMsilent::P5E4. TGTAGGAATTCGACATCAAGCTTATCGATACCG | |
| Commercial assay or kit | PowerFecal DNA Isolation Kit | MoBio Laboratories | Cat# 12830-50 | |
| Commercial assay or kit | NextSeq 500/550 High Output Kit v2.5 (300 cycles) | Illumina | Cat# 20024908 | |
| Commercial assay or kit | Genomic-tip 20/G | QIAGEN | Cat# 13323 | |
| Commercial assay or kit | Qubit dsDNA HS Assay Kit | Thermo Fisher Scientific | Cat# Q33231 | |
| Commercial assay or kit | Ligation Sequencing Kit | Oxford Nanopore Technologies | Cat# SQK-LSK110 | |
| Commercial assay or kit | HMW DNA Extraction Kit | New England Biolabs | Cat# T3060 | |
| Commercial assay or kit | Wizard HMW DNA Extraction Kit | Promega | Cat# A2920 | |
| Commercial assay or kit | DNeasy Blood & Tissue Kit | QIAGEN | Cat# 69504 | |
| Commercial assay or kit | Illumina DNA Prep Kit | Illumina | Cat# 20018704 | |
| Commercial assay or kit | IDT for Illumina DNA/RNA UD Indexes, Set A | Integrated DNA Technologies | Cat# 20027213 | |
| Commercial assay or kit | ExoSAP-IT | Thermo Fisher Scientific | Cat# 78201.1.ML | |
| Commercial assay or kit | SMRTbell Express Template Prep Kit v2.0 | Pacific Biosciences | ||
| Commercial assay or kit | E-Z 96 DNA Kit | Omega Bio-tek | Cat# BD96-01 | |
| Commercial assay or kit | AMPure XP beads | Bruker | ||
| Commercial assay or kit | SequalPrep Normalization Plate Kit | Thermo Scientific | Cat# A1051001 | |
| Commercial assay or kit | KAPA HiFi HotStart ReadyMix (2x) | Roche | ||
| Commercial assay or kit | SsoAdvanced Universal SYBR Green Supermix | Bio-Rad | ||
| Software, algorithm | Trimmomatic | Bolger et al., 2014 | v0.39 | |
| Software, algorithm | Bowtie2 | Langmead and Salzberg, 2012 | ||
| Software, algorithm | Kraken2-Bracken Snakemake pipeline (custom, CMMG-based) | https://github.com/SilasK/Krak | ||
| Software, algorithm | MUFFIN | Van Damme et al., 2021; https://github.com/RVanDamme/MUFFIN | v1.0.6 | |
| Software, algorithm | MetaFlye | Kolmogorov et al., 2019; Kolmogorov, 2020; https://github.com/mikolmogorov/Flye | v2.7 | |
| Software, algorithm | Polypolish | Wick and Holt, 2022; https://github.com/rrwick/Polypolish | v0.5.0 | |
| Software, algorithm | CONCOCT | Alneberg et al., 2014 | v1.1.0 | |
| Software, algorithm | MetaBAT2 | Kang et al., 2019 | v2.13 | |
| Software, algorithm | MaxBin2 | https://sourceforge.net/projects/maxbin2/ | v2.2.7 | |
| Software, algorithm | metaWRAP | Uritskiy et al., 2018 | v1.2.2 | |
| Software, algorithm | Unicycler | Wick et al., 2017 | v0.4.7 | |
| Software, algorithm | Unicycler | Wick et al., 2017 | v0.4.8 | |
| Software, algorithm | CheckM | Parks et al., 2015 | v1.0.13 | |
| Software, algorithm | GTDB-tk | Chaumeil et al., 2019 | v2.1.0 | |
| Software, algorithm | Prokka | Seemann, 2014 | v1.12 | |
| Software, algorithm | Prokka | Seemann, 2014 | v1.14.6 | |
| Software, algorithm | BWA-MEM | Li, 2013 | ||
| Software, algorithm | samtools | Li et al., 2009 | ||
| Software, algorithm | Trycycler | Wick et al., 2021 | v0.5.3 | |
| Software, algorithm | Flye | Kolmogorov et al., 2019 | v2.9-b1768 | |
| Software, algorithm | Miniasm / Minipolish | Wick and Holt, 2019 | v0.3-r179; v0.1.2 | |
| Software, algorithm | Raven | lbcb-sci, 2022; https://github.com/lbcb-sci/raven | v1.8.1 | |
| Software, algorithm | Pilon | Walker et al., 2014 | v1.24 | |
| Software, algorithm | BreSeq | Deatherage and Barrick, 2014 | v0.38.3 | |
| Software, algorithm | minimap2 | Li, 2018 | ||
| Software, algorithm | CD-Search | Marchler-Bauer et al., 2009 | ||
| Software, algorithm | Foldseek | van Kempen et al., 2024 | ||
| Software, algorithm | Geneious Prime | Geneious; https://www.geneious.com | 2024.0.5 | |
| Software, algorithm | BBDuk | Other (BBTools, distributed within Geneious Prime) | v38.84 | |
| Software, algorithm | SMRT Link | Pacific Biosciences | v11.0.0.146107 | |
| Software, algorithm | QIIME 2 | Bolyen et al., 2019 | v2020.11 | |
| Software, algorithm | dRep | Olm et al., 2017; Kieser et al., 2022 | v3.5.0 | |
| Software, algorithm | GraphPad Prism | GraphPad Software | v10.2.3 | |
| Software, algorithm | Custom ICE-seq analysis script | Gallagher, 2019 |
Additional files
-
Supplementary file 1
Description of genomes and metagenome assembled genomes from the WildR murine gut microbiome.
- https://cdn.elifesciences.org/articles/110200/elife-110200-supp1-v1.xlsx
-
Supplementary file 2
Comparison of the T6SS sturctural genes in B. acidifaciens WildR to GA1 T6SSs in Bacteroides spp. isolated from humans.
- https://cdn.elifesciences.org/articles/110200/elife-110200-supp2-v1.xlsx
-
Supplementary file 3
B. acidifaciens and B. caecimuris methylated motifs identified by PacBio sequencing.
- https://cdn.elifesciences.org/articles/110200/elife-110200-supp3-v1.xlsx
-
Supplementary file 4
Media and growth conditions for isolating and culturing select species from the WildR gut microbiome.
- https://cdn.elifesciences.org/articles/110200/elife-110200-supp4-v1.xlsx
-
Supplementary file 5
Gene fragments used in this study.
- https://cdn.elifesciences.org/articles/110200/elife-110200-supp5-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/110200/elife-110200-mdarchecklist1-v1.pdf
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
The type VI secretion system governs strain maintenance in a wild mammalian gut microbiome
eLife 15:RP110200.
https://doi.org/10.7554/eLife.110200.3
